NDE1 (NM_001143979) Human Untagged Clone
SKU
SC324955
NDE1 (untagged)-Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NDE1 |
Synonyms | HOM-TES-87; LIS4; MHAC; NDE; NUDE; NUDE1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC324955 representing NM_001143979.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGACTCCGGAAAGACTTTCAGCTCCGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCGATG ACCTACAAACAGAGGGCAGAAAATACGCAAGAGGAACTCCGAGAATTCCAGGAGGGAAGCCGAGAATAT GAAGCTGAATTGGAGACGCAGCTGCAACAAATTGAAACCAGGAACAGAGACCTCCTGTCCGAAAATAAC CGCCTTCGCATGGAGCTGGAAACCATCAAGGAGAAGTTTGAAGTGCAGCACTCTGAAGGCTACCGGCAG ATCTCAGCCTTGGAGGATGACCTCGCGCAGACCAAAGCCATTAAAGACCAATTGCAGAAATACATCAGA GAGCTGGAGCAAGCAAATGACGACCTGGAAAGAGCCAAGCGCGCCACGATCATGTCTCTCGAAGACTTT GAGCAGCGCTTGAATCAGGCCATCGAAAGAAATGCCTTCCTGGAAAGTGAACTTGATGAAAAAGAGAAT CTCCTGGAATCTGTTCAGAGACTGAAGGATGAAGCCAGAGATTTGCGGCAGGAACTGGCCGTGCAGCAG AAGCAGGAGAAACCCAGGACCCCCATGCCCAGCTCAGTGGAAGCTGAGAGGACAGACACAGCTGTGCAG GCCACGGGCTCCGTGCCGTCCACGCCCATTGCTCACCGAGGACCCAGCTCAAGTTTAAACACACCTGGG AGCTTCAGACGTGGCCTGGACGACTCCACCGGGGGGACCCCCCTCACACCTGCGGCCCGGATATCAGCC CTCAACATTGTGGGAGACCTACTGCGGAAAGTCGGGGCACTGGAGTCCAAACTCGCTTCCTGCCGGAAC CTCGTGTACGATCAGTCCCCAAACCGAACAGGTGGCCCAGCCTCTGGGCGGAGCAGCAAGAACAGAGAT GGCGGGGAGAGACGGCCAAGCAGCACCAGCGTGCCTTTGGGTGATAAGGGGTTGGACACGAGTTGCCGC TGGTTGTCCAAATCAACAACCAGGTCGTCCAGCTCCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143979 |
Insert Size | 1008 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001143979.1 |
RefSeq Size | 3936 bp |
RefSeq ORF | 1008 bp |
Locus ID | 54820 |
UniProt ID | Q9NXR1 |
Cytogenetics | 16p13.11 |
MW | 37.7 kDa |
Summary | This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC227919 | NDE1 (Myc-DDK-tagged)-Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1 | 10 ug |
$457.00
|
|
RC227919L3 | Lenti ORF clone of Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC227919L4 | Lenti ORF clone of Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
RG227919 | NDE1 (tGFP-tagged) - Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1 | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.