NEIL2 (NM_001135746) Human Untagged Clone

SKU
SC324951
NEIL2 (untagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NEIL2
Synonyms NEH2; NEI2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324951 representing NM_001135746.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAGAAGGGCCGTTGGTGAGGAAATTTCACCATTTGGTCTCCCCCTTTGTGGGTCAGCAGGTGGTC
AAGACAGGGGGCAGCAGTAAGAAGCTACAGCCCGCCAGCCTGCAGTCTCTGTGGCTCCAGGACACCCAG
GTCCATGGAAAGAAATTATTCCTTAGATTTGATCTAGATGAAGAAATGGGGCCCCCTGGCAGCAGCCCA
ACACCAGAGCCTCCACAAAAAGAAGTGCAGAAGGAAGGGGCTGCGGACCCAAAGCAGGTCGGGGAGCCC
AGCGGGCAGAAGACCCTTGATGGATCCTCACGGTCTGCAGAGCTCGTCCCCCAGGGCGAGGATGATTCT
GAGTATTTGGAGAGAGACGCCCCTGCAGGAGATGCTGGGAGGTGGCTGCGTGTCAGCTTTGGTTTGTTT
GGCAGCGTTTGGGTGAACGATTTCTCCAGAGCCAAGAAAGCCAACAAGAGGGGGGACTGGAGGGACCCT
TCCCCGAGGTTGGTCCTGCACTTTGGTGGTGGTGGCTTCCTGGCATTTTATAATTGTCAGTTGTCTTGG
AGCTCTTCCCCAGTGGTCACACCCACCTGTGACATCCTGTCTGAGAAGTTCCATCGAGGACAAGCCTTA
GAAGCTCTAGGCCAGGCTCAGCCTGTCTGCTATACACTGCTGGACCAGAGATACTTCTCAGGGCTAGGG
AACATCATTAAGAATGAAGCCTTGTACAGAGCTGGGATCCATCCCCTTTCTCTCGGTTCAGTCCTGAGT
GCCTCGCGTCGGGAGGTCCTGGTGGATCACGTGGTGGAGTTCAGTACAGCCTGGCTGCAGGGCAAGTTC
CAAGGCAGACCGCAGCACACACAGGTCTACCAGAAAGAACAGTGCCCTGCTGGCCACCAGGTCATGAAG
GAGGCGTTTGGGCCCGAAGATGGGTTACAGAGGCTCACCTGGTGGTGCCCGCAGTGCCAGCCCCAGTTG
TCAGAGGAGCCAGAGCAGTGCCAGTTCTCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001135746
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001135746.1
RefSeq Size 2202 bp
RefSeq ORF 999 bp
Locus ID 252969
UniProt ID Q969S2
Cytogenetics 8p23.1
Protein Families Druggable Genome
Protein Pathways Base excision repair
MW 36.8 kDa
Summary This gene encodes a member of the Fpg/Nei family of DNA glycosylases. These glycosylases initiate the first step in base excision repair by cleaving oxidatively damaged bases and introducing a DNA strand break via their abasic site lyase activity. This enzyme is primarily associated with DNA repair during transcription and acts prefentially on cytosine-derived lesions, particularly 5-hydroxyuracil and 5-hydroxycytosine. It contains an N-terminal catalytic domain, a hinge region, and a C-terminal DNA-binding domain with helix-two-turn-helix and zinc finger motifs. This enzyme interacts with the X-ray cross complementing factor 1 scaffold protein as part of a multi-protein DNA repair complex. A pseudogene of this gene has been identified. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 8 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:NEIL2 (NM_001135746) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227701 NEIL2 (Myc-DDK-tagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 2 10 ug
$300.00
RC227701L3 Lenti ORF clone of Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC227701L4 Lenti ORF clone of Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 2, mGFP tagged 10 ug
$600.00
RG227701 NEIL2 (tGFP-tagged) - Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.