Parvin gamma (PARVG) (NM_001137606) Human Untagged Clone

SKU
SC324950
PARVG (untagged)-Human parvin, gamma (PARVG), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Parvin gamma
Synonyms AI413459; gamma-parvin; OTTMUSP00000032048; parvin, gamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324950 representing NM_001137606.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCGGAGTTCTTGTACGACCTGCTGCAGCTCCCCAAGGGGGTGGAGCCCCCAGCGGAGGAGGAG
CTCTCAAAAGGAGGAAAGAAGAAATACCTGCCACCCACTTCCCGGAAGGACCCCAAATTTGAAGAACTG
CAGAAGGTGTTGATGGAGTGGATCAATGCCACTCTTCTCCCCGAGCACATTGTGGTCCGCAGCCTGGAG
GAGGACATGTTCGACGGGCTCATCCTACACCACCTATTCCAGAGGCTGGCGGCGCTCAAGCTGGAAGCA
GAGGACATCGCCCTGACAGCCACAAGCCAGAAGCACAAGCTCACAGTGGTGCTGGAGGCCGTGAACCGG
AGTCTGCAGCTGGAGGAGTGGCAGGCCAAGTGGAGCGTGGAGAGCATCTTCAACAAGGACCTGTTGTCT
ACCCTGCACCTCCTTGTGGCCCTGGCCAAGCGCTTCCAGCCCGACCTCTCCCTCCCAACCAACGTCCAG
GTGGAGGTCATCACTATCGAGAGCACCAAAAGTGGTCTGAAGTCAGAGAAGTTGGTGGAACAGCTCACT
GAATACAGCACAGACAAGGACGAGCCTCCAAAGGACGTCTTTGATGAATTATTTAAGCTGGCTCCGGAG
AAAGTGAACGCAGTGAAAGAGGCCATCGTGAACTTTGTCAACCAGAAGCTGGACCGCCTGGGCCTGTCT
GTGCAGAATCTGGACACCCAGTTTGCAGATGGGGTCATCTTACTCTTGCTGATTGGACAACTTGAAGGC
TTCTTCCTGCACTTAAAGGAATTCTACCTCACTCCCAACTCTCCTGCAGAAATGCTGCACAACGTCACC
CTGGCGCTGGAGCTGCTGAAGGACGAGGGCCTGCTCAGCTGCCCTGTCAGCCCTGAAGATATCGTGAAC
AAGGATGCCAAGAGCACACTGAGGGTGCTCTATGGTCTGTTCTGCAAGCACACGCAGAAGGCACACAGG
GACAGGACGCCCCATGGAGCCCCGAATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001137606
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001137606.1
RefSeq Size 1991 bp
RefSeq ORF 996 bp
Locus ID 64098
Cytogenetics 22q13.31
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Focal adhesion, Hypertrophic cardiomyopathy (HCM), Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Tight junction, Vibrio cholerae infection, Viral myocarditis
MW 37.5 kDa
Summary Members of the parvin family, including PARVG, are actin-binding proteins associated with focal contacts.[supplied by OMIM, Aug 2004]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1).
Write Your Own Review
You're reviewing:Parvin gamma (PARVG) (NM_001137606) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227051 PARVG (Myc-DDK-tagged)-Human parvin, gamma (PARVG), transcript variant 3 10 ug
$300.00
RC227051L3 Lenti ORF clone of Human parvin, gamma (PARVG), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC227051L4 Lenti ORF clone of Human parvin, gamma (PARVG), transcript variant 3, mGFP tagged 10 ug
$600.00
RG227051 PARVG (tGFP-tagged) - Human parvin, gamma (PARVG), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.