HYLS1 (NM_001134793) Human Untagged Clone

SKU
SC324912
HYLS1 (untagged)-Human hydrolethalus syndrome 1 (HYLS1), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HYLS1
Synonyms HLS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324912 representing NM_001134793.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAACTTCTACCTGATGGACAAATATGGGCTAATATGGATCCAGAAGAACGAATGTTGGCAGCT
GCTACAGCTTTTACCCACATCTGTGCAGGGCAGGGTGAAGGAGATGTCAGGAGAGAAGCCCAATCTATC
CAATATGATCCCTACAGTAAAGCTTCAGTAGCCCCAGGGAAGCGACCTGCTCTTCCTGTGCAACTACAG
TACCCACATGTAGAAAGTAATGTCCCTTCAGAAACAGTCTCTGAGGCCTCCCAAAGACTCCGAAAGCCA
GTGATGAAGAGAAAGGTGCTGCGCAGAAAGCCAGATGGGGAAGTATTAGTAACAGATGAGTCGATTATC
AGTGAATCAGAATCTGGTACAGAAAATGATCAGGATCTCTGGGACTTAAGACAAAGGCTGATGAATGTA
CAGTTCCAGGAAGACAAGGAATCTTCATTTGATGTTTCACAAAAATTTAACCTACCACATGAATACCAA
GGAATTTCTCAAGATCAGCTCATTTGCTCTCTACAAAGAGAAGGAATGGGCTCTCCAGCTTACGAACAA
GACCTGATTGTTGCCAGCAGACCCAAGTCCTTTATTCTCCCAAAGCTGGACCAGTTAAGCCGAAACCGG
GGCAAGACAGACCGGGTAGCCCGGTATTTTGAGTACAAACGGGACTGGGACTCAATACGTTTACCTGGT
GAAGATCATAGAAAGGAATTACGCTGGGGTGTCCGAGAGCAGATGCTTTGTCGAGCAGAACCCCAATCC
AAACCTCAGCATATATATGTCCCAAACAATTATCTAGTACCAACAGAGAAGAAAAGGTCTGCACTCCGT
TGGGGTGTTCGTTGTGACCTTGCAAATGGTGTCATACCCAGGAAGCTTCCCTTCCCTCTTTCTCCTTCT
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001134793
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001134793.1
RefSeq Size 2073 bp
RefSeq ORF 900 bp
Locus ID 219844
UniProt ID Q96M11
Cytogenetics 11q24.2
MW 34.4 kDa
Summary This gene encodes a protein localized to the cytoplasm. Mutations in this gene are associated with hydrolethalus syndrome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:HYLS1 (NM_001134793) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225414 HYLS1 (Myc-DDK-tagged)-Human hydrolethalus syndrome 1 (HYLS1), transcript variant 2 10 ug
$300.00
RC225414L3 Lenti ORF clone of Human hydrolethalus syndrome 1 (HYLS1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC225414L4 Lenti ORF clone of Human hydrolethalus syndrome 1 (HYLS1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG225414 HYLS1 (tGFP-tagged) - Human hydrolethalus syndrome 1 (HYLS1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.