C7orf50 (NM_001134395) Human Untagged Clone

SKU
SC324777
C7orf50 (untagged)-Human chromosome 7 open reading frame 50 (C7orf50), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C7orf50
Synonyms YCR016W
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324777 representing NM_001134395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAAAACAGAAGAGAAAAGTTCCTGAAGTGACAGAGAAAAAGAACAAAAAGCTGAAGAAGGCGTCA
GCAGAGGGGCCACTGCTGGGCCCTGAGGCTGCACCAAGTGGCGAAGGAGCCGGCTCCAAGGGCGAAGCT
GTGCTCAGGCCCGGGCTGGACGCAGAGCCAGAGCTGTCCCCAGAGGAGCAGAGGGTCCTGGAAAGGAAG
CTGAAAAAGGAACGGAAGAAAGAGGAGAGGCAGCGTCTGCGGGAGGCAGGCCTTGTGGCCCAGCACCCG
CCTGCCAGGCGCTCGGGGGCCGAACTGGCCCTGGACTACCTCTGCAGATGGGCCCAAAAGCACAAGAAC
TGGAGGTTTCAGAAGACGAGGCAGACGTGGCTCCTGCTGCACATGTATGACAGTGACAAGGTTCCCGAT
GAGCACTTCTCCACCCTGCTGGCCTACCTGGAGGGGCTGCAGGGCCGGGCCCGAGAGCTGACGGTGCAG
AAGGCGGAAGCCCTGATGCGGGAGCTGGATGAGGAGGGCTCTGATCCCCCCCTGCCGGGGAGGGCCCAG
CGCATCCGACAGGTGCTGCAGCTGCTCTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001134395
Insert Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001134395.1
RefSeq Size 1301 bp
RefSeq ORF 585 bp
Locus ID 84310
UniProt ID Q9BRJ6
Cytogenetics 7p22.3
MW 22.1 kDa
Write Your Own Review
You're reviewing:C7orf50 (NM_001134395) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225215 C7orf50 (Myc-DDK-tagged)-Human chromosome 7 open reading frame 50 (C7orf50), transcript variant 2 10 ug
$300.00
RC225215L3 Lenti ORF clone of Human chromosome 7 open reading frame 50 (C7orf50), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC225215L4 Lenti ORF clone of Human chromosome 7 open reading frame 50 (C7orf50), transcript variant 2, mGFP tagged 10 ug
$600.00
RG225215 C7orf50 (tGFP-tagged) - Human chromosome 7 open reading frame 50 (C7orf50), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.