MAGP1 (MFAP2) (NM_001135247) Human Untagged Clone

SKU
SC324766
MFAP2 (untagged)-Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAGP1
Synonyms MAGP; MAGP-1; MAGP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324766 representing NM_001135247.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGAGCTGCCTACCTCTTCCTGCTATTCCTGCCTGGCTTGCTGGCTCAGGGCCAGTATGACCTGGAC
CCGCTGCCGCCGTTCCCTGACCACGTCCAGTACACCCACTATAGCGACCAGATCGACAACCCAGACTAC
TATGATTATCAAGAGGTGACTCCTCGGCCCTCCGAGGAACAGTTCCAGTTCCAGTCCCAGCAGCAAGTC
CAACAGGAAGTCATCCCAGCCCCAACCCCAGAACCAGGAAATGCAGAGCTGGAGCCCACAGAGCCTGGG
CCTCTTGACTGCCGTGAGGAACAGTACCCGTGCACCCGCCTCTACTCCATACACAGGCCTTGCAAACAG
TGTCTCAACGAGGTCTGCTTCTACAGCCTCCGCCGTGTGTACGTCATTAACAAGGAGATCTGTGTTCGT
ACAGTGTGTGCCCATGAGGAGCTCCTCCGAGCTGACCTCTGTCGGGACAAGTTCTCCAAATGTGGCGTG
ATGGCCAGCAGCGGCCTGTGCCAATCCGTGGCGGCCTCCTGTGCCAGGAGCTGTGGGAGCTGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001135247
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001135247.1
RefSeq Size 1102 bp
RefSeq ORF 549 bp
Locus ID 4237
UniProt ID P55001
Cytogenetics 1p36.13
Protein Families Secreted Protein
MW 20.8 kDa
Summary Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (3) uses an alternate in-frame splice site and differs in the 5' UTR compared to variant 2. The resulting isoform (b) has the same N- and C-termini but is one aa shorter compared to isoform a. Variants 3 and 4 both encode isoform b.
Write Your Own Review
You're reviewing:MAGP1 (MFAP2) (NM_001135247) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225196 MFAP2 (Myc-DDK-tagged)-Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3 10 ug
$300.00
RC225196L3 Lenti ORF clone of Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC225196L4 Lenti ORF clone of Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3, mGFP tagged 10 ug
$600.00
RG225196 MFAP2 (tGFP-tagged) - Human microfibrillar-associated protein 2 (MFAP2), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.