Xg blood group (XG) (NM_001141920) Human Untagged Clone

SKU
SC324765
XG (untagged)-Human Xg blood group (XG), transcript variant 3
$330.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Xg blood group
Synonyms PBDX
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001141920, the custom clone sequence may differ by one or more nucleotides
ATGGAGAGCTGGTGGGGACTTCCCTGTCTTGCGTTCCTGTGTTTTCTAATGCACGCCCGA
GGTCAAAGAGACTTTGATTTGGCAGATGCCCTTGATGACCCTGAACCCACCAAGAAGCCA
AACTCAGATATCTACCCAAAGCCAAAACCACCTTACTACCCACAGCCCGAGAATCCCGAC
AGCGGTGGAAATATCTACCCAAGGCCAAAGCCACGCCCTCAACCCCAGCCTGGCAATTCC
GGCAACAGTGGAGGTAGTTACTTCAATGATGTGGACCGTGATGACGGACGCTACCCGCCC
AGGCCCAGGCCACGGCCGCCTGCAGGAGGTGGCGGCGGTGGCTACTCCAGTTATGGCAAC
TCCGACAACACGCACGGTGGAGATCACCATTCAACGTATGGCAATCCAGAAGGCAATATG
GTAGCAAAAATCGTGTCTCCCATCGTATCCGTGGTGGTGGTGACACTGCTGGGAGCAGCA
GCCAGTTATTTCAAACTAAACAATAGGAGAAATTGTTTCAGGACCCATGAACCAGAAAAT
GTC
Restriction Sites Please inquire
ACCN NM_001141920
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001141920.1, NP_001135392.1
RefSeq Size 2902 bp
RefSeq ORF 546 bp
Locus ID 7499
UniProt ID P55808
Cytogenetics Xp22.33
Protein Families Transmembrane
Summary This gene encodes the XG blood group antigen, and is located at the pseudoautosomal boundary on the short (p) arm of chromosome X. The three 5' exons reside in the pseudoautosomal region and the remaining exons within the X-specific end. A truncated copy of this gene is found on the Y chromosome at the pseudoautosomal boundary. It is transcribed, but not expected to make a Y-chromosome specific gene product. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (3) uses an alternate donor splice site at one of the coding exons compared to transcript variant 1, resulting in an isoform (3) containing one additional aa compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Sequence Note: This RefSeq record represents the XG*001.1.1 allele.
Write Your Own Review
You're reviewing:Xg blood group (XG) (NM_001141920) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227042 XG (Myc-DDK-tagged)-Human Xg blood group (XG), transcript variant 3 10 ug
$330.00
RC227042L3 Lenti-ORF clone of XG (Myc-DDK-tagged)-Human Xg blood group (XG), transcript variant 3 10 ug
$630.00
RC227042L4 Lenti-ORF clone of XG (mGFP-tagged)-Human Xg blood group (XG), transcript variant 3 10 ug
$630.00
RG227042 XG (tGFP-tagged) - Human Xg blood group (XG), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.