LMO2 (NM_001142315) Human Untagged Clone

SKU
SC324747
LMO2 (untagged)-Human LIM domain only 2 (rhombotin-like 1) (LMO2), transcript variant 2
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LMO2
Synonyms LMO-2; RBTN2; RBTNL1; RHOM2; TTG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324747 representing NM_001142315.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCTCGGCCATCGAAAGGAAGAGCCTGGACCCTTCAGAGGAACCAGTGGATGAGGTGCTGCAGATC
CCCCCATCCCTGCTGACATGCGGCGGCTGCCAGCAGAACATTGGGGACCGCTACTTCCTGAAGGCCATC
GACCAGTACTGGCACGAGGACTGCCTGAGCTGCGACCTCTGTGGCTGCCGGCTGGGTGAGGTGGGGCGG
CGCCTCTACTACAAACTGGGCCGGAAGCTCTGCCGGAGAGACTATCTCAGGCTTTTTGGGCAAGACGGT
CTCTGCGCATCCTGTGACAAGCGGATTCGTGCCTATGAGATGACAATGCGGGTGAAAGACAAAGTGTAT
CACCTGGAATGTTTCAAATGCGCCGCCTGTCAGAAGCATTTCTGTGTAGGTGACAGATACCTCCTCATC
AACTCTGACATAGTGTGCGAACAGGACATCTACGAGTGGACTAAGATCAATGGGATGATATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001142315
Insert Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142315.1
RefSeq Size 1605 bp
RefSeq ORF 477 bp
Locus ID 4005
UniProt ID P25791
Cytogenetics 11p13
Protein Families Druggable Genome
MW 18.4 kDa
Summary LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream in-frame ATG and an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).
Write Your Own Review
You're reviewing:LMO2 (NM_001142315) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226762 LMO2 (Myc-DDK-tagged)-Human LIM domain only 2 (rhombotin-like 1) (LMO2), transcript variant 2 10 ug
$150.00
RC226762L3 Lenti ORF clone of Human LIM domain only 2 (rhombotin-like 1) (LMO2), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC226762L4 Lenti ORF clone of Human LIM domain only 2 (rhombotin-like 1) (LMO2), transcript variant 2, mGFP tagged 10 ug
$450.00
RG226762 LMO2 (tGFP-tagged) - Human LIM domain only 2 (rhombotin-like 1) (LMO2), transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.