FKBP2 (NM_001135208) Human Untagged Clone

SKU
SC324731
FKBP2 (untagged)-Human FK506 binding protein 2, 13kDa (FKBP2), transcript variant 3
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FKBP2
Synonyms FKBP-13; FKBP13; PPIase
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324731 representing NM_001135208.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCATCTGCCTGAGCGCCGTGGCCACGGCCACG
GGGGCCGAGGGCAAAAGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTGGACCACTGTCCCATCAAATCG
CGCAAAGGGGATGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAGTTTGACAGCAGC
CTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTTGGCACAGGCCAGGTCATCAAGGGCTGGGACCAGGGG
CTGCTGGGGATGTGTGAGGGGGAAAAGCGCAAGCTGGTGATCCCATCCGAGCTAGGGTATGGAGAGCGG
GGAGCTCCCCCAAAGATTCCAGGCGGTGCAACCCTGGTGTTCGAGGTGGAGCTGCTCAAAATAGAGCGA
CGAACTGAGCTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001135208
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001135208.1
RefSeq Size 662 bp
RefSeq ORF 429 bp
Locus ID 2286
UniProt ID P26885
Cytogenetics 11q13.1
Protein Families Druggable Genome
MW 15.6 kDa
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 6 encode the same isoform.
Write Your Own Review
You're reviewing:FKBP2 (NM_001135208) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225120 FKBP2 (Myc-DDK-tagged)-Human FK506 binding protein 2, 13kDa (FKBP2), transcript variant 3 10 ug
$150.00
RC225120L3 Lenti ORF clone of Human FK506 binding protein 2, 13kDa (FKBP2), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC225120L4 Lenti ORF clone of Human FK506 binding protein 2, 13kDa (FKBP2), transcript variant 3, mGFP tagged 10 ug
$450.00
RG225120 FKBP2 (tGFP-tagged) - Human FK506 binding protein 2, 13kDa (FKBP2), transcript variant 3 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.