EIF3E (NM_001568) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | EIF3E |
Synonyms | eIF3-p46; EIF3-P48; EIF3S6; INT6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001568.2
CTTTTTTTTTTTTTCTTTGGCAAGATGGCGGAGTACGACTTGACTACTCGCATCGCGCAC
TTTTTGGATCGGCATCTAGTCTTTCCGCTTCTTGAATTTCTCTCTGTAAAGGAGATATAT AATGAAAAGGAATTATTACAAGGTAAATTGGACCTTCTTAGTGATACCAACATGGTAGAC TTTGCTATGGATGTATACAAAAACCTTTATTCTGATGATATTCCTCATGCTTTGAGAGAG AAAAGAACCACAGTGGTTGCACAACTGAAACAGCTTCAGGCAGAAACAGAACCAATTGTG AAGATGTTTGAAGATCCAGAAACTACAAGGCAAATGCAGTCAACCAGGGATGGTAGGATG CTCTTTGACTACCTGGCGGACAAGCATGGTTTTAGGCAGGAATATTTAGATACACTCTAC AGATATGCAAAATTCCAGTACGAATGTGGGAATTACTCAGGAGCAGCAGAATATCTTTAT TTTTTTAGAGTGCTGGTTCCAGCAACAGATAGAAATGCTTTAAGTTCACTCTGGGGAAAG CTGGCCTCTGAAATCTTAATGCAGAATTGGGATGCAGTCATGGAAGACCTTACACGGTTA AAAGAGACCATAGATAATAATTCTGTGAGTTCTCCACTTCAGTCTCTTCAGCAGAGAACA TGGCTCATTCACTGGTCTCTGTTTGTTTTCTTCAATCACCCCAAAGGTCGCGATAATATT ATTGACCTCTTCCTTTATCAGCCACAATATCTTAATGCAATTCAGACAATGTGTCCACAC ATTCTTCGCTATTTGACTACAGCAGTCATAACAAACAAGGATGTTCGAAAACGTCGGCAG GTTCTAAAAGATCTAGTTAAAGTTATTCAACAGGAGTCTTACACATATAAAGACCCAATT ACAGAATTTGTTGAATGTTTATATGTTAACTTTGACTTTGATGGGGCTCAGAAAAAGCTG AGGGAATGTGAATCAGTGCTTGTGAATGACTTCTTCTTGGTGGCTTGTCTTGAGGATTTC ATTGAAAATGCCCGTCTCTTCATATTTGAGACTTTCTGTCGCATCCACCAGTGTATCAGC ATTAACATGTTGGCAGATAAATTGAACATGACTCCAGAAGAAGCTGAAAGGTGGATTGTA AATTTGATTAGAAATGCAAGACTGGATGCCAAGATTGATTCTAAATTAGGTCATGTGGTT ATGGGTAACAATGCAGTCTCACCCTATCAGCAAGTGATTGAAAAGACCAAAAGCCTTTCC TTTAGAAGCCAGATGTTGGCCATGAATATTGAGAAGAAACTTAATCAGAATAGCAGGTCA GAGGCTCCTAACTGGGCAACTCAAGATTCTGGCTTCTACTGAAGAACCATAAAGAAAAGA TGAAAAAAAAAACTATCAAAGAAAGATGAAATAATAAAACTATTATATAAAGGGTGACTT ACATTTTGGAAACAACATATTACGTATAAATTTTGAAGAATTGGAATAAAATTGATTCAT TCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001568 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001568.2, NP_001559.1 |
RefSeq Size | 1516 bp |
RefSeq ORF | 1338 bp |
Locus ID | 3646 |
UniProt ID | P60228 |
Cytogenetics | 8q23.1 |
Domains | PCI |
Summary | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773). Required for nonsense-mediated mRNA decay (NMD); may act in conjunction with UPF2 to divert mRNAs from translation to the NMD pathway (PubMed:17468741). May interact with MCM7 and EPAS1 and regulate the proteasome-mediated degradation of these proteins (PubMed:17310990, PubMed:17324924).[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC204788 | EIF3E (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 3, subunit E (EIF3E) | 10 ug |
$457.00
|
|
RC204788L1 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit E (EIF3E), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC204788L2 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit E (EIF3E), mGFP tagged | 10 ug |
$757.00
|
|
RC204788L3 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit E (EIF3E), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC204788L4 | Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit E (EIF3E), mGFP tagged | 10 ug |
$757.00
|
|
RG204788 | EIF3E (tGFP-tagged) - Human eukaryotic translation initiation factor 3, subunit E (EIF3E) | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
SC119138 | EIF3E (untagged)-Human eukaryotic translation initiation factor 3, subunit E (EIF3E) | 10 ug |
$457.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.