RPL6 (NM_001024662) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | RPL6 |
Synonyms | L6; SHUJUN-2; TAXREB107; TXREB1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001024662.1
ATCTTGCAAGGTAAGAATCGCGGGCCTGTCTGCAAGACTTGAGTTCAGGACTCCCAATCC
TTCGCCATCCGAACCTGGAGGGCATCCAGTCGACACCTACAGGGGTCGGACATGTCCAAG GCTAACTGAGAGGCCTTCCAGACGCTTCATTTTTGTTGTTTGGGTTTGCGGCAGGGCACA AAGAGGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAAGAGACCCGAAGCC AAGAAGGTTGATGCTGGTGGCAAGGTGAAAAAGGGTAACCTCAAAGCTAAAAAGCCCAAG AAGGGGAAGCCCCATTGCAGCCGCAACCCTGTCCTTGTCAGAGGAGTTGGCAGGTATTCC CGATCTGCCATGTATTCCAGAAAGGCCATGTACAAGAGGAAGTACTCAGCCGCTAAATCC AAGGTTGAAAAGAAAAAGAAGGAGAAGGTTCTCGCAACTGTTACAAAACCAGTTGGTGGT GACAAGAACGGCGGTACCCGGGTGGTTAAACTTCGCAAAATGCCTAGATATTATCCTACT GAAGATGTGCCTCGAAAGCTGTTGAGCCACGGCAAAAAACCCTTCAGTCAGCACGTGAGA AAACTGCGAGCCAGCATTACCCCCGGGACCATTCTGATCATCCTCACTGGACGCCACAGG GGCAAGAGGGTGGTTTTCCTGAAGCAGCTGGCTAGTGGCTTATTACTTGTGACTGGACCT CTGGTCCTCAATCGAGTTCCTCTACGAAGAACACACCAGAAATTTGTCATTGCCACTTCA ACCAAAATCGATATCAGCAATGTAAAAATCCCAAAACATCTTACTGATGCTTACTTCAAG AAGAAGAAGCTGCGGAAGCCCAGACACCAGGAAGGTGAGATCTTCGACACAGAAAAAGAG AAATATGAGATTACGGAGCAGCGCAAGATTGATCAGAAAGCTGTGGACTCACAAATTTTA CCAAAAATCAAAGCTATTCCTCAGCTCCAGGGCTACCTGCGATCTGTGTTTGCTCTGACG AATGGAATTTATCCTCACAAATTGGTGTTCTAAATGTCTTAAGAACCTAATTAAATAGCT GACTACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001024662 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001024662.1, NP_001019833.1 |
RefSeq Size | 1148 bp |
RefSeq ORF | 867 bp |
Locus ID | 6128 |
UniProt ID | Q02878 |
Cytogenetics | 12q24.13 |
Protein Families | Transcription Factors |
Protein Pathways | Ribosome |
Summary | This gene encodes a protein component of the 60S ribosomal subunit. This protein can bind specifically to domain C of the tax-responsive enhancer element of human T-cell leukemia virus type 1, and may participate in tax-mediated transactivation of transcription. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 5, 6, and 7 encode the same isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205119 | RPL6 (Myc-DDK-tagged)-Human ribosomal protein L6 (RPL6), transcript variant 1 | 10 ug |
$300.00
|
|
RC205119L1 | Lenti ORF clone of Human ribosomal protein L6 (RPL6), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC205119L2 | Lenti ORF clone of Human ribosomal protein L6 (RPL6), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC205119L3 | Lenti ORF clone of Human ribosomal protein L6 (RPL6), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC205119L4 | Lenti ORF clone of Human ribosomal protein L6 (RPL6), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG205119 | RPL6 (tGFP-tagged) - Human ribosomal protein L6 (RPL6), transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.