STK32A (NM_145001) Human Untagged Clone

SKU
SC324606
STK32A (untagged)-Human serine/threonine kinase 32A (STK32A), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol STK32A
Synonyms YANK1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_145001.1 GGGCCTTGCTCTTGGAGTTCTTCTCTTAGTCCCTGTTCCCTGGATGAAAGCATCGCTCCG
AGCCTCATGGGAGGAATGAAGGAAGAATCGAGACTAGATATCCAACTAAGGCTTCGGGAC
ATGTTTTGAGCGAAGATGGGTGTTTCTGCCCGGATAGTATAAATCGAGGATCCAGGTCTG
GGCAGATTCAACCATGGGAGCCAACACTTCAAGAAAACCACCAGTGTTTGATGAAAATGA
AGATGTCAACTTTGACCACTTTGAAATTTTGCGAGCCATTGGGAAAGGCAGTTTTGGGAA
GGTCTGCATTGTACAGAAGAATGATACCAAGAAGATGTACGCAATGAAGTACATGAATAA
ACAAAAGTGCGTGGAGCGCAATGAAGTGAGAAATGTCTTCAAGGAACTCCAGATCATGCA
GGGTCTGGAGCACCCTTTCCTGGTTAATTTGTGGTATTCCTTCCAAGATGAGGAAGACAT
GTTCATGGTGGTGGACCTCCTGCTGGGTGGAGACCTGCGTTATCACCTGCAACAGAACGT
CCACTTCAAGGAAGAAACAGTGAAGCTCTTCATCTGTGAGCTGGTCATGGCCCTGGACTA
CCTGCAGAACCAGCGCATCATTCACAGGGATATGAAGCCTGACAATATTTTACTTGACGA
ACATGATACCTGGCTCTCCTACAAGTCCCACTGAATTGGAGTTTCAGGAGACCGAAGCCC
AGGCACATGTATTTTGCAAAACTACACTGAAGTTTCTGATAATGACGGATATCAACAATT
AAACGCTTACTTCTTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_145001
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145001.1, NP_659438.1
RefSeq Size 827 bp
RefSeq ORF 501 bp
Locus ID 202374
UniProt ID Q8WU08
Cytogenetics 5q32
Protein Families Druggable Genome, Protein Kinase
Write Your Own Review
You're reviewing:STK32A (NM_145001) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204769 STK32A (Myc-DDK-tagged)-Human serine/threonine kinase 32A (STK32A), transcript variant 2 10 ug
$150.00
RC204769L1 Lenti ORF clone of Human serine/threonine kinase 32A (STK32A), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC204769L2 Lenti ORF clone of Human serine/threonine kinase 32A (STK32A), transcript variant 2, mGFP tagged 10 ug
$450.00
RC204769L3 Lenti ORF clone of Human serine/threonine kinase 32A (STK32A), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC204769L4 Lenti ORF clone of Human serine/threonine kinase 32A (STK32A), transcript variant 2, mGFP tagged 10 ug
$450.00
RG204769 STK32A (tGFP-tagged) - Human serine/threonine kinase 32A (STK32A), transcript variant 2 10 ug
$489.00
SC100039 STK32A (untagged)-Human serine/threonine kinase 32A (STK32A), transcript variant 2 10 ug
$300.00
SC323391 STK32A (untagged)-Kinase deficient mutant (K52M) of Human serine/threonine kinase 32A (STK32A), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.