Neuromedin B (NMB) (NM_021077) Human Untagged Clone

SKU
SC324393
NMB (untagged)-Human neuromedin B (NMB), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Neuromedin B
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_021077.3 GAAGAGAGGCTCAGAGGGCTGAAGTGCCTATTTGGCCGAAAGCCGTGGCAGAGTGGCAAG
GCAGGGCCAGGGGAAGCGGCTCCGCCGCCGGGGCCGGGCCCCTGTTTGGCCCGGTGCCCG
GTCCTTAGCCTGAAGGTGGCGGGCTTCCGCCAGAAGCCCCTGGCGGAAGCGGTGCCCGCG
TGCGGGCCAGAGTGTGGGTGTGCAGGTCTCTGGGCGGCCCAAAGGGGGTGCCCCTGCCTG
GTAACCTAGCGGGAGGGTGGGGACGGCGGGGAGGGCGGCGGGCGCGGGGCACGGCTCCGC
TGCTCAGGGCAGGCTCCGCCCCCAGGGGCGCGGATTTAAAAGGATCGAAGGCAGCCCCGG
AGCCCAGCGGCCGGGAGGCGCGCCCGAACGAAGCCGCGGCCCGGGCACAGCCATGGCCCG
GCGGGCGGGGGGCGCTCGGATGTTCGGCAGCCTCCTGCTCTTCGCCCTGCTCGCTGCCGG
CGTCGCCCCGCTCAGCTGGGATCTCCCGGAGCCCCGCAGCCGAGCCAGCAAGATCCGAGT
GCACTCGCGAGGCAACCTCTGGGCCACCGGTCACTTCATGGGCAAGAAGAGTCTGGAGCC
TTCCAGCCCATCCCCATTGGGGACAGCTACCCACACCTCCCTGAGGGACCAGCGACTGCA
GCTGAGTCATGATCTGCTCGGAATCCTCCTGCTAAAGAAGGCTCTGGGCGTGAGCCTCAG
CCGCCCCGCACCCCAAATCCAGGAGGCTGCTGGTACAAATACTGCAGAAATGACACCAAT
AATGGGGCAGACACAACAGCGTGGCTTAGATTGTGCCCACCCAGGGAAGGTGCTGAATGG
GACCCTGTTGATGGCCCCATCTGGATGTAAATCCTGAGCTCAAATCTCTGTTACTCCATT
ACTGTGATTTCTGGCTGGGTCACCAGAAATATCGCTGATGCAGACACAGATTATGTTCCT
GCTGTATTTCCTGCTTCCCTGTTGAATTGGTGAATAAAACCTTGCTCTTTACATACAAAA
AAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_021077
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021077.3, NP_066563.2
RefSeq Size 1046 bp
RefSeq ORF 366 bp
Locus ID 4828
UniProt ID P08949
Cytogenetics 15q25.2
Domains Bombesin
Protein Families Secreted Protein, Transmembrane
Summary This gene encodes a member of the bombesin-like family of neuropeptides, which negatively regulate eating behavior. The encoded protein may regulate colonic smooth muscle contraction through binding to its cognate receptor, the neuromedin B receptor (NMBR). Polymorphisms of this gene may be associated with hunger, weight gain and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform (1).
Write Your Own Review
You're reviewing:Neuromedin B (NMB) (NM_021077) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200705 NMB (Myc-DDK-tagged)-Human neuromedin B (NMB), transcript variant 1 10 ug
$300.00
RC200705L1 Lenti ORF clone of Human neuromedin B (NMB), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200705L2 Lenti ORF clone of Human neuromedin B (NMB), transcript variant 1, mGFP tagged 10 ug
$600.00
RC200705L3 Lenti ORF clone of Human neuromedin B (NMB), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200705L4 Lenti ORF clone of Human neuromedin B (NMB), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200705 NMB (tGFP-tagged) - Human neuromedin B (NMB), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC113025 NMB (untagged)-Human neuromedin B (NMB), transcript variant 1 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.