CD63 (NM_001780) Human Untagged Clone
CAT#: SC324357
CD63 (untagged)-Human CD63 molecule (CD63), transcript variant 1
"NM_001780" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CD63 |
Synonyms | LAMP-3; ME491; MLA1; OMA81H; TSPAN30 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001780.4
GGCCGGGGGGCGCAGCTAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGC
CTTGGGAAGCCCAGGCCCGGCAGCCATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTT CTTGCTCTACGTCCTCCTGCTGGCCTTTTGCGCCTGTGCAGTGGGACTGATTGCCGTGGG TGTCGGGGCACAGCTTGTCCTGAGTCAGACCATAATCCAGGGGGCTACCCCTGGCTCTCT GTTGCCAGTGGTCATCATCGCAGTGGGTGTCTTCCTCTTCCTGGTGGCTTTTGTGGGCTG CTGCGGGGCCTGCAAGGAGAACTATTGTCTTATGATCACGTTTGCCATCTTTCTGTCTCT TATCATGTTGGTGGAGGTGGCCGCAGCCATTGCTGGCTATGTGTTTAGAGATAAGGTGAT GTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCGAAAAACAACCACAC TGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACAC AGATTGGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAA TGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGT GGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCAGCCCTTGG AATTGCTTTTGTCGAGGTTTTGGGAATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAG AAGTGGCTACGAGGTGATGTAGGGGTCTGGTCTCCTCAGCCTCCTCATCTGGGGGAGTGG AATAGTATCCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001780 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001780.4, NP_001771.1 |
RefSeq Size | 1031 bp |
RefSeq ORF | 717 bp |
Locus ID | 967 |
UniProt ID | P08962 |
Cytogenetics | 12q13.2 |
Domains | transmembrane4 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Lysosome |
Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (1) encodes the longest isoform (A). Variants 1, 3, 4, 5 and 10 encode the same isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201733 | CD63 (Myc-DDK-tagged)-Human CD63 molecule (CD63), transcript variant 1 |
USD 300.00 |
|
RC201733L1 | Lenti ORF clone of Human CD63 molecule (CD63), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC201733L2 | Lenti ORF clone of Human CD63 molecule (CD63), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RC201733L3 | Lenti ORF clone of Human CD63 molecule (CD63), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC201733L4 | Lenti ORF clone of Human CD63 molecule (CD63), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG201733 | CD63 (tGFP-tagged) - Human CD63 molecule (CD63), transcript variant 1 |
USD 500.00 |
|
SC126650 | CD63 (untagged)-Human CD63 molecule (CD63), transcript variant 1 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review