GAGE7 (NM_021123) Human Untagged Clone

SKU
SC324173
GAGE7 (untagged)-Human G antigen 7 (GAGE7)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GAGE7
Synonyms AL4; CT4.7; GAGE-7
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_021123.1 AAGAACGCCAGGGAGCTGTGAGGCAGTGCTGTGTGGTTCCTGCCGTCCGGACTCTTTTTC
CTCTACTGAGATTCATCTGTGTGAAATATGAGTTGGCGAGGAAGATCGACCTATTATTGG
CCTAGACCAAGGCGCTATGTACAGCCTCCTGAAGTGATTGGGCCTATGCGGCCCGAGCAG
TTCAGTGATGAAGTGGAACCAGCAACACCTGAAGAAGGGGAACCAGCAACTCAACGTCAG
GATCCTGCAGCTGCTCAGGAGGGAGAGGATGAGGGAGCATCTGCAGGTCAAGGGCCGAAG
CCTGAAGCTGATAGCCAGGAACAGGGTCACCCACAGACTGGGTGTGAGTGTGAAGATGGT
CCTGATGGGCAGGAGATGGACCCGCCAAATCCAGAGGAGGTGAAAACGCCTGAAGAAGGT
GAAAAGCAATCACAGTGTTAAAAGAAGGCACGTTGAAATGATGCAGGCTGCTCCTATGTT
GGAAATTTGTTCATTAAAATTCTCCCAATAAAGCTTTACAGCCTTCTGCAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_021123
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021123.1, NP_066946.1
RefSeq Size 524 bp
RefSeq ORF 354 bp
Locus ID 2579
UniProt ID O76087
Cytogenetics Xp11.4-p11.2
Write Your Own Review
You're reviewing:GAGE7 (NM_021123) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204459 GAGE7 (Myc-DDK-tagged)-Human G antigen 7 (GAGE7) 10 ug
$150.00
RC204459L1 Lenti ORF clone of Human G antigen 7 (GAGE7), Myc-DDK-tagged 10 ug
$450.00
RC204459L2 Lenti ORF clone of Human G antigen 7 (GAGE7), mGFP tagged 10 ug
$450.00
RC204459L3 Lenti ORF clone of Human G antigen 7 (GAGE7), Myc-DDK-tagged 10 ug
$450.00
RC204459L4 Lenti ORF clone of Human G antigen 7 (GAGE7), mGFP tagged 10 ug
$450.00
RG204459 GAGE7 (tGFP-tagged) - Human G antigen 7 (GAGE7) 10 ug
$489.00
SC112972 GAGE7 (untagged)-Human G antigen 7 (GAGE7) 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.