HEBP2 (NM_014320) Human Untagged Clone

SKU
SC324137
HEBP2 (untagged)-Human heme binding protein 2 (HEBP2)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HEBP2
Synonyms C6orf34; C6ORF34B; PP23; SOUL
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014320.2 CGCATCGGGTGGGCTCGGGTCTCCAGCCCGGCCGGGAGGAGGGACCGGCTCTGCGGAGCG
GGGACTCGGGGCCTCGGCGGGGCGCGCACACGCAGGCGGGGCGGCCCGGGGTGCGGGGCC
TCTGCGCGGCTGACCAGGCTCCCAGAGCGTCAGCGCCGCCCATGGCCGAGCCGCTCCAGC
CAGACCCCGGGGCGGCCGAGGACGCGGCGGCCCAAGCTGTGGAGACGCCGGGCTGGAAGG
CCCCGGAGGACGCCGGCCCCCAGCCCGGAAGTTATGAGATCCGACACTATGGACCAGCCA
AGTGGGTCAGCACGTCCGTGGAGTCTATGGACTGGGATTCAGCCATCCAGACGGGCTTTA
CGAAACTGAACAGCTACATTCAAGGCAAAAACGAGAAAGAGATGAAAATAAAGATGACAG
CTCCAGTGACAAGCTACGTGGAGCCTGGTTCAGGTCCTTTTAGTGAGTCTACCATTACCA
TTTCCCTGTATATTCCCTCTGAACAGCAATTTGATCCACCCAGGCCTTTAGAGTCAGATG
TCTTCATTGAAGATAGAGCCGAAATGACTGTGTTTGTACGGTCTTTCGATGGATTTTCTA
GTGCCCAAAAGAATCAAGAACAACTTTTGACATTAGCAAGCATTTTAAGGGAAGATGGAA
AAGTTTTCGATGAGAAGGTTTACTACACTGCAGGCTACAACAGTCCTGTCAAATTGCTTA
ATAGAAATAATGAAGTGTGGTTGATTCAAAAAAATGAACCCACCAAAGAAAACGAATGAG
AAAAATGAAAGGAAGTTCTGCTGTCAGAGGCAAAACATCTGTTTATCATAGACATCAACA
TGACCTATAAGTAAAGTGCGTGTCTAGTGTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_014320
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014320.2, NP_055135.1
RefSeq Size 1282 bp
RefSeq ORF 618 bp
Locus ID 23593
UniProt ID Q9Y5Z4
Cytogenetics 6q24.1
Domains SOUL
Summary The protein encoded by this gene is found predominately in the cytoplasm, where it plays a role in the collapse of mitochondrial membrane potential (MMP) prior to necrotic cell death. The encoded protein enhances outer and inner mitochondrial membrane permeabilization, especially under conditions of oxidative stress. [provided by RefSeq, May 2016]
Write Your Own Review
You're reviewing:HEBP2 (NM_014320) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203899 HEBP2 (Myc-DDK-tagged)-Human heme binding protein 2 (HEBP2) 10 ug
$300.00
RC203899L1 Lenti ORF clone of Human heme binding protein 2 (HEBP2), Myc-DDK-tagged 10 ug
$600.00
RC203899L2 Lenti ORF clone of Human heme binding protein 2 (HEBP2), mGFP tagged 10 ug
$600.00
RC203899L3 Lenti ORF clone of Human heme binding protein 2 (HEBP2), Myc-DDK-tagged 10 ug
$600.00
RC203899L4 Lenti ORF clone of Human heme binding protein 2 (HEBP2), mGFP tagged 10 ug
$600.00
RG203899 HEBP2 (tGFP-tagged) - Human heme binding protein 2 (HEBP2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC115037 HEBP2 (untagged)-Human heme binding protein 2 (HEBP2) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.