Glutathione Peroxidase 4 (GPX4) (NM_002085) Human Untagged Clone

SKU
SC324086
GPX4 (untagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
$462.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Glutathione Peroxidase 4
Synonyms GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002085.3 GAGCGCTCTGGAGGGCGTGGCCGTGGGAAAGGAGGCGCGGAAAGCCGACGCGCGTCCATT
GGTCGGCTGGACGAGGGGAGGAGCCGCTGGCTCCCAGCCCCGCCGCGATGAGCCTCGGCC
GCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGG
CCGGGACCATGTGCGCGTCCCGGGACGACTGGCGCTGTGCGCGCTCCATGCACGAGTTTT
CCGCCAAGGACATCGACGGGCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCA
TCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCG
ACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGT
TCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACG
TCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGA
AGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACT
TCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGG
AGCCCCTGGTGATAGAGAAGGACCTGCCCCACTATTTCTAGCTCCACAAGTGTGTGGCCC
CGCCCGAGCCCCTGCCCACGCCCTTGGAGCCTTCCACCGGCACTCATGACGGCCTGCCTG
CAAACCTGCTGGTGGGGCAGACCCGAAAATCCAGCGTGCACCCCGCCGGAGGAAGGTCCC
ATGGCCTGCTGGGCTTGGCTCGGCGCCCCCACCCCTGGCTACCTTGTGGGAATAAACAGA
CAAATTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_002085
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002085.3, NP_002076.2
RefSeq Size 942 bp
Locus ID 2879
UniProt ID P36969
Cytogenetics 19p13.3
Protein Families Druggable Genome
Protein Pathways Arachidonic acid metabolism, Glutathione metabolism
Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the canonical isoform A. A similar isoform in rat (L-form) has been shown to be localized to the mitochondria (PMID:9988735). CCDS Note: This CCDS ID represents a selenoprotein that is functionally sensitive to selenium levels (e.g., PMID:14642406). Position 73 of the protein is a selenocysteine residue, which is cotranslationally incorporated when a UGA codon, which is normally a stop codon, is recognized by a specific selenocysteyl-tRNA in conjunction with a stem-loop SECIS element in the 3' UTR.
Write Your Own Review
You're reviewing:Glutathione Peroxidase 4 (GPX4) (NM_002085) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208065 GPX4 (Myc-DDK-tagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note, selenocysteine protein, internal stop codon, see reference data summary) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC208065L1 Lenti-ORF, GPX4 (Myc-DDK-tagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note, selenocystein protein, internal stop codon, see summary) 10 ug
$600.00
RC208065L2 Lenti-ORF, GPX4 (mGFP-tagged) - Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note: selenocystein protein, Internal stop codon present. See Summary below) 10 ug
$600.00
RC208065L3 Lenti-ORF, GPX4 (Myc-DDK-tagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note, selenocystein protein, internal stop codon, see summary) 10 ug
$600.00
RC208065L4 Lenti-ORF, GPX4 (mGFP-tagged) - Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note: selenocystein protein, Internal stop codon present. See Summary below) 10 ug
$600.00
RG208065 GPX4 (GFP-tagged) - Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) 10 ug
$489.00
SC118821 GPX4 (untagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) 10 ug
$462.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.