SULT1A1 (NM_001055) Human Untagged Clone

SKU
SC324000
SULT1A1 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SULT1A1
Synonyms HAST1/HAST2; P-PST; P-PST 1; PST; ST1A1; ST1A3; STP; STP1; ts-PST; TSPST1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001055.2 CACAACACCCACAATCAGCCACTGCGGGCGAGGAGGGCACGAGGCCAGGTTCCCAAGAGC
TCAGGAACATGGAGCTGATCCAGGACACCTCCCGCCCGCCACTGGAGTACGTGAAGGGGG
TCCCGCTCATCAAGTACTTTGCAGAGGCACTGGGGCCCCTGCAGAGCTTCCAGGCCCGGC
CTGATGACCTGCTCATCAGCACCTACCCCAAGTCCGGCACTACCTGGGTAAGCCAGATTC
TGGACATGATCTACCAGGGTGGTGACCTGGAGAAGTGTCACCGAGCTCCCATCTTCATGC
GGGTGCCCTTCCTTGAGTTCAAAGCCCCAGGGATTCCCTCAGGGATGGAGACTCTGAAAG
ACACACCGGCCCCACGACTCCTGAAGACACACCTGCCCCTGGCTCTGCTCCCCCAGACTC
TGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGCAACGCAAAGGATGTGGCAGTTT
CCTACTACCACTTCTACCACATGGCCAAGGTGCACCCTGAGCCTGGGACCTGGGACAGCT
TCCTGGAGAAGTTCATGGTCGGAGAAGTGTCCTACGGATCCTGGTACCAGCACGTGCAGG
AGTGGTGGGAGCTGAGCCGCACCCACCCTGTTCTCTACCTCTTCTATGAAGACATGAAGG
AGAACCCGAAAAGGGAGATTCAAAAGATCCTGGAGTTTGTGGGGCACTCCCTGCCAGAGG
AGACCGTGGACTTCGTGGTTCAGCACACGTCGTTCAAGGAGATGAAGAAGAACCCTATGA
CCAACTACACCACCGTCCCCCAGGAGTTCATGGACCACAGCATCTCCCCCTTCATGAGGA
AAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATG
CGGACTATGCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGAGAGG
GGCTCCTGGAGTCACTGCAGAGGGAGTGTGCGAATCAAACCTGACCAAGCGGCTCAAGAA
TAAAATATGAATTGAGGGCCCGGGACGGTAGGTCATGTCTGTAATCCCAGCAATTTGGAG
GCTGAGGTGGGAGGATCATTTGAGCCCAGGAGTTCGAGACCAACCTGGGCAACATAGTGA
GATTCTGTTAAAAAAATAAAATAAAATAAAACCAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_001055
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001055.2, NP_001046.2
RefSeq Size 1222 bp
RefSeq ORF 888 bp
Locus ID 6817
UniProt ID P50225
Cytogenetics 16p11.2
Domains Sulfotransfer
Protein Pathways Sulfur metabolism
Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Multiple alternatively spliced variants that encode two isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is the predominant transcript. Variants 1, 2, 3 and 4 encode the same isoform (a).
Write Your Own Review
You're reviewing:SULT1A1 (NM_001055) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201601 SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1 10 ug
$450.00
RC201601L1 Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC201601L2 Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1, mGFP tagged 10 ug
$750.00
RC201601L3 Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC201601L4 Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1, mGFP tagged 10 ug
$750.00
RG201601 SULT1A1 (tGFP-tagged) - Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1 10 ug
$650.00
SC119452 SULT1A1 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.