Growth Hormone (GH1) (NM_022559) Human Untagged Clone

SKU SC323886

GH1 (untagged)-Human growth hormone 1 (GH1), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: Growth Hormone
• Synonyms: GH; GH-N; GHB5; GHN; hGH-N; IGHD1A; IGHD1B; IGHD2
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_022559.2 CCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGCTGCAATGGCTACAGGCTCCCGGA; CGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCT; TCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGC; ACCAGCTGGCCTTTGACACCTACCAGGAGTTTAACCCCCAGACCTCCCTCTGTTTCTCAG; AGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCAACCTAGAGCTGC; TCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTG; TCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACCTCCTAAAGG; ACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGATGGCAGCCCCCGGACTG; GGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGATGACGCAC; TACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACAT; TCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGT; GGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGC; CCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: ECoRI-NOT
• ACCN: NM_022559
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_022559.2, NP_072053.1
• RefSeq Size: 777 bp
• RefSeq ORF: 609 bp
• Locus ID: 2688
• UniProt ID: P01241
• Cytogenetics: 17q23.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
• Summary: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed in the pituitary but not in placental tissue as is the case for the other four genes in the growth hormone locus. Mutations in or deletions of the gene lead to growth hormone deficiency and short stature. [provided by RefSeq, Jul 2008]; Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (b) is shorter, compared to isoform 1.