C20orf7 (NDUFAF5) (NM_001039375) Human Untagged Clone

SKU
SC323882
NDUFAF5 (untagged)-Human chromosome 20 open reading frame 7 (C20orf7), nuclear gene encoding mitochondrial protein, transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C20orf7
Synonyms bA526K24.2; C20orf7; dJ842G6.1; MC1DN16
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001039375.1 AATTGGGGTCGCAGCTGGAGATGCTGCGGCCGGCAGGGCTCTGGCGCTTATGTCGGCGAC
CTTGGGCGGCGAGGGTCCCAGCGGAGAATCTTGGCCGTAGGGAAGTCACCTCTGGTGTCT
CTCCCCGCGGTAGCACCTCGCCCAGAACCCTGAATATTTTCGACCGGGATTTGAAAAGGA
AACAGAAGAACTGGGCAGCCCGGCAGCCCGAGCCGACCAAATTTGACTACCTGAAGGAGG
AGGTTGGAAGTCGGATCGCAGACCGTGTATATGACATACCCAGAAATTTCCCCCTTGCTT
TGGATCTTGGTTGTGGAAGAGGTTACATTGCACAATATTTGAATAAGCTTCAGTTATTCC
ATTGCAGGAAACTATTGGAAAGTTTTTCCAAGCTGACATTGCAGAAAATGCTTTGTTTGC
ATTGGGTGAATGACCTTCCTAGAGCACTTGAGCAGATTCATTATATTTTAAAACCAGATG
GAGTGTTTATCGGTGCAATGTTTGGAGGCGACACACTCTATGAACTTCGGTGTTCCTTAC
AGTTAGCGGAAACGGAAAGGGAAGGAGGATTTTCTCCACACATTTCTCCTTTCACTGCTG
TCAATGACCTGGGACATCTGCTTGGGAGAGCTGGCTTTAATACTCTGACTGTGGACACTG
ATGAAATTCAAGTTAACTATCCTGGAATGTTTGAATTGATGGAAGATTTACAAGGTATGG
GTGAGAGTAACTGTGCTTGGAATAGAAAAGCCCTGCTGCATCGAGACACAATGCTGGCAG
CTGCGGCAGTGTACAGAGAAATGTACAGAAATGAAGATGGTTCAGTACCTGCTACATACC
AGATCTATTACATGATAGGATGGAAATATCATGAGTCACAGGCAAGACCAGCTGAAAGAG
GTTCCGCAACTGTGTCATTTGGAGAGCTAGGAAAAATAAACAACCTTATGCCACCGGGGA
AAAAATCACAATAAATATTTATTCAGTGAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_001039375
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039375.1, NP_001034464.1
RefSeq Size 1021 bp
RefSeq ORF 954 bp
Locus ID 79133
UniProt ID Q5TEU4
Cytogenetics 20p12.1
Protein Families Druggable Genome
Summary The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:C20orf7 (NDUFAF5) (NM_001039375) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210078 NDUFAF5 (Myc-DDK-tagged)-Human chromosome 20 open reading frame 7 (C20orf7), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$300.00
RC210078L3 Lenti ORF clone of Human chromosome 20 open reading frame 7 (C20orf7), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC210078L4 Lenti ORF clone of Human chromosome 20 open reading frame 7 (C20orf7), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged 10 ug
$600.00
RG210078 NDUFAF5 (tGFP-tagged) - Human chromosome 20 open reading frame 7 (C20orf7), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.