C20orf7 (NDUFAF5) (NM_001039375) Human Untagged Clone

SKU SC323882

NDUFAF5 (untagged)-Human chromosome 20 open reading frame 7 (C20orf7), nuclear gene encoding mitochondrial protein, transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: C20orf7
• Synonyms: bA526K24.2; C20orf7; dJ842G6.1; MC1DN16
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001039375.1 AATTGGGGTCGCAGCTGGAGATGCTGCGGCCGGCAGGGCTCTGGCGCTTATGTCGGCGAC; CTTGGGCGGCGAGGGTCCCAGCGGAGAATCTTGGCCGTAGGGAAGTCACCTCTGGTGTCT; CTCCCCGCGGTAGCACCTCGCCCAGAACCCTGAATATTTTCGACCGGGATTTGAAAAGGA; AACAGAAGAACTGGGCAGCCCGGCAGCCCGAGCCGACCAAATTTGACTACCTGAAGGAGG; AGGTTGGAAGTCGGATCGCAGACCGTGTATATGACATACCCAGAAATTTCCCCCTTGCTT; TGGATCTTGGTTGTGGAAGAGGTTACATTGCACAATATTTGAATAAGCTTCAGTTATTCC; ATTGCAGGAAACTATTGGAAAGTTTTTCCAAGCTGACATTGCAGAAAATGCTTTGTTTGC; ATTGGGTGAATGACCTTCCTAGAGCACTTGAGCAGATTCATTATATTTTAAAACCAGATG; GAGTGTTTATCGGTGCAATGTTTGGAGGCGACACACTCTATGAACTTCGGTGTTCCTTAC; AGTTAGCGGAAACGGAAAGGGAAGGAGGATTTTCTCCACACATTTCTCCTTTCACTGCTG; TCAATGACCTGGGACATCTGCTTGGGAGAGCTGGCTTTAATACTCTGACTGTGGACACTG; ATGAAATTCAAGTTAACTATCCTGGAATGTTTGAATTGATGGAAGATTTACAAGGTATGG; GTGAGAGTAACTGTGCTTGGAATAGAAAAGCCCTGCTGCATCGAGACACAATGCTGGCAG; CTGCGGCAGTGTACAGAGAAATGTACAGAAATGAAGATGGTTCAGTACCTGCTACATACC; AGATCTATTACATGATAGGATGGAAATATCATGAGTCACAGGCAAGACCAGCTGAAAGAG; GTTCCGCAACTGTGTCATTTGGAGAGCTAGGAAAAATAAACAACCTTATGCCACCGGGGA; AAAAATCACAATAAATATTTATTCAGTGAAAAAAAAAAAAAAAA
• Restriction Sites: ECoRI-NOT
• ACCN: NM_001039375
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001039375.1, NP_001034464.1
• RefSeq Size: 1021 bp
• RefSeq ORF: 954 bp
• Locus ID: 79133
• UniProt ID: Q5TEU4
• Cytogenetics: 20p12.1
• Protein Families: Druggable Genome
• Summary: The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]; Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.