MAPKAP Kinase 2 (MAPKAPK2) (NM_004759) Human Untagged Clone

SKU
SC323636
MAPKAPK2 (untagged)-Kinase deficient mutant (K93M) of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAPKAP Kinase 2
Synonyms MAPKAP-K2; MK-2; MK2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004759, the custom clone sequence may differ by one or more nucleotides


ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCGCCGCCGCAGCCCC
CCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCGCCCCCGCAGCAGTTCCCGCAGTTCCA
CGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATCGATGACTACAAGGTCACCAGCCAGGTCCTG
GGGCTGGGCATCAACGGCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAA
TGCTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACAT
CGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGT
TTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCAT
CCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACATTGCCCATCGGGATGT
CAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAACGCCATCCTGAAACTCACTGACTTTGGCTTT
GCCAAGGAAACCACCAGCCACAACTCTTTGACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAG
TGCTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCT
GTGTGGGTATCCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGA
ATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATGCTCATTCGGA
ATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATGAACCACCCTTGGATCATGCA
ATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGGGTCCTGAAGGAGGACAAGGAGCGGTGGGAG
GATGTCAAGGGGTGTCTTCATGACAAGAACAGCGACCAGGCCACTTGGCTGACCAGGTTGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for mutant NM_004759 unedited
CCGCCGTTGAGCAATGGGCGGTAGGCGTGTACGGAGGGAGGTCTATATAAGCAGAGCTCATTTAGGTGAC
ACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATTCGGCACGAGGCCCGGAGCCGGAGG
AGGGGGTATTATTAGGGCTAGCCACGCGTCCCCGGGACCGGGGGCGGGGCCGGCTAAACGGTTCGGCCAA
CCACATGGGAAACGACGGCGCGAAACCGGAAGGCTCGGCCTCAACAGAGCGAGTAGAGTAGTACCAACAA
CCCCCCGGCACAGGGGGAAAAAAAGGGTCCACCCCAAAAACCAACCACACAAACCACACTATCTTGGGGG
GGGGGGGGGTCA
Kinase Domain Sequence
>SC323636 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
TRTTCAGCAGGTCTGGGGCTGGGCATCACGGCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAA
ATTCGCCCTCATGATGCTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCC
CAGTGCCCGCACATCGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGA
TTGTCATGGAATGTTTGGACGGTGGAGAACTCTTTAGCCGAATCC
Restriction Sites Please inquire
ACCN NM_004759
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004759.3, NP_004750.1
RefSeq Size 3608 bp
RefSeq ORF 1113 bp
Locus ID 9261
UniProt ID P49137
Cytogenetics 1q32.1
Domains pkinase, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways MAPK signaling pathway, Neurotrophin signaling pathway, VEGF signaling pathway
Summary This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:MAPKAP Kinase 2 (MAPKAPK2) (NM_004759) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220487 MAPKAPK2 (Myc-DDK-tagged)-Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1 10 ug
$457.00
RC220487L1 Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC220487L2 Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, mGFP tagged 10 ug
$757.00
RC220487L3 Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC220487L4 Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, mGFP tagged 10 ug
$757.00
RG220487 MAPKAPK2 (tGFP-tagged) - Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1 10 ug
$657.00
SC311111 MAPKAPK2 (untagged)-Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1 10 ug
$503.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.