ERK2 (MAPK1) (NM_138957) Human Untagged Clone
SKU
SC323422
MAPK1 (untagged)-Kinase deficient mutant (K54M) of Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ERK2 |
Synonyms | ERK; ERK-2; ERK2; ERT1; MAPK2; NS13; p38; p40; p41; p41mapk; p42-MAPK; P42MAPK; PRKM1; PRKM2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF within SC323422 sequence for NM_138957 edited (data generated by NextGen Sequencing)
ATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGCAGGTGTTCGAC GTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGAGGGCGCCTACGGCATGGTGTGC TCTGCTTATGATAATGTCAACAAAGTTCGAGTAGCTATCATGAAAATCAGCCCCTTTGAG CACCAGACCTACTGCCAGAGAACCCTGAGGGAGATAAAAATCTTACTGCGCTTCAGACAT GAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGAT GTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACAC CTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATC CATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACC TGTGATCTCAAGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCAC ACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTG AATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAA ATGCTTTCTAACAGGCCCATCTTTCCAGGGAAGCATTATCTTGACCAGCTGAACCACATT TTGGGTATTCTTGGATCCCCATCACAAGAAGACCTGAATTGTATAATAAATTTAAAAGCT AGGAACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGCCATGGAACAGGCTGTTCCCA AATGCTGACTCCAAAGCTCTGGACTTATTGGACAAAATGTTGACATTCAACCCACACAAG AGGATTGAAGTAGAACAGGCTCTGGCCCACCCATATCTGGAGCAGTATTACGACCCGAGT GACGAGCCCATCGCCGAAGCACCATTCAAGTTCGACATGGAATTGGATGACTTGCCTAAG GAAAAGCTCAAAGAACTAATTTTTGAAGAGACTGCTAGATTCCAGCCAGGATACAGATCT TAA Clone variation with respect to NM_138957.2 161 a=>t
5' Read Nucleotide Sequence
>OriGene 5' read for mutant NM_138957 unedited
ACCGCCCGTCTCAGCAAAGGGCGGTAGGCGCTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGT GAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCAGGCAGGCAG GCAATCGGTCCGAGTGGCTGTCGGCTCTTCAGCTCTCCCGCTCGGCGTCTTCCTTCCTCCTCCCGGTCAG CGTCGGCGGCTGCACCGGCGGCGGCGCAGTCCCTGCGGGAGGGGCGACAAGAGCTGAGCGGCGGCCGCCG AGCGTCGAGCTCAGCGCGGCGAGGCGGCGGCGGCCCGGCAGCCAACATGGGGGGCGGGGGGGCGGGGCGG GCCCGGAGAAGGACGAGGCCAAGGAATGAAACGGGGCCGCCCTACCCAACTATAGGGAAGCCGGCAAGGG GCCAAAAGACTGATGTGAGATAAAAAAAAAGAAACAAACGAAGAA
Kinase Domain Sequence
>SC323422 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
CYATGMMGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGT CAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCAGGCAGGCAGGCAATCG GTCCGAGTGGCTGTCGGCTCTTCAGCTCTCCCGCTCGGCGTCTTCCTTCCTCCTCCCGGTCAGCGTCGGC GGCTGCACCGGCGGCGGCGCAGTCCCTGCGGGAGGGGCGACAAGA |
Restriction Sites | Please inquire |
ACCN | NM_138957 |
Insert Size | 5000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_138957.2, NP_620407.1 |
RefSeq Size | 1499 bp |
RefSeq ORF | 1083 bp |
Locus ID | 5594 |
UniProt ID | P28482 |
Cytogenetics | 22q11.22 |
Domains | pkinase, S_TKc, TyrKc |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Acute myeloid leukemia, Adherens junction, Alzheimer's disease, Axon guidance, B cell receptor signaling pathway, Bladder cancer, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Long-term depression, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Non-small cell lung cancer, Oocyte meiosis, Pancreatic cancer, Pathways in cancer, Prion diseases, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway, TGF-beta signaling pathway, Thyroid cancer, Toll-like receptor signaling pathway, Type II diabetes mellitus, Vascular smooth muscle contraction, VEGF signaling pathway |
Summary | This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (2) contains a different 3' UTR region, compared to variant 1. Both variants 1 and 2 encode the same protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC204703 | MAPK1 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2 | 10 ug |
$457.00
|
|
RC204703L1 | Lenti ORF clone of Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC204703L2 | Lenti ORF clone of Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RC204703L3 | Lenti ORF clone of Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC204703L4 | Lenti ORF clone of Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RG204703 | MAPK1 (tGFP-tagged) - Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.