TOMM40 (NM_001128917) Human Untagged Clone

SKU
SC323000
TOMM40 (untagged)-Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TOMM40
Synonyms C19orf1; D19S1177E; PER-EC1; PEREC1; TOM40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC323000 representing NM_001128917.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAACGTGTTGGCTGCCAGCTCGCCGCCCGCAGGGCCGCCACCGCCGCCTGCGCCGGCCCTCGTG
GGGCTGCCGCCACCTCCGCCCTCGCCGCCGGGCTTCACGCTGCCGCCGCTGGGAGGCAGCCTGGGCGCC
GGCACCAGTACGAGTCGAAGTTCGGAACGGACCCCCGGGGCTGCAACCGCCAGCGCCTCAGGGGCCGCC
GAGGATGGGGCCTGCGGCTGCCTGCCCAACCCGGGCACATTCGAGGAGTGCCACCGGAAGTGCAAGGAG
CTGTTTCCCATTCAGATGGAGGGTGTCAAGCTCACAGTCAACAAAGGGTTGAGTAACCATTTTCAGGTC
AACCACACAGTAGCCCTCAGCACAATCGGGGAGTCCAACTACCACTTCGGGGTCACATATGTGGGGACA
AAGCAGCTGAGTCCCACAGAGGCGTTCCCTGTACTGGTGGGTGACATGGACAACAGTGGCAGTCTCAAC
GCTCAGGTCATTCACCAGCTGGGCCCCGGTCTCAGGTCCAAGATGGCCATCCAGACCCAGCAGTCGAAG
TTTGTGAACTGGCAGGTGGACGGGGAGTATCGGGGCTCTGACTTCACAGCAGCCGTCACCCTGGGGAAC
CCAGACGTCCTCGTGGGTTCAGGAATCCTCGTAGCCCACTACCTCCAGAGCATCACGCCTTGCCTGGCC
CTGGGTGGAGAGCTGGTCTACCACCGGCGGCCTGGAGAGGAGGGCACTGTCATGTCTCTAGCTGGGAAA
TACACATTGAACAACTGGTTGGCAACGGTAACGTTGGGCCAGGCGGGCATGCACGCAACATACTACCAC
AAAGCCAGTGACCAGCTGCAGGTGGGTGTGGAGTTTGAGGCCAGCACAAGGATGCAGGACACCAGCGTC
TCCTTCGGGTACCAGCTGGACCTGCCCAAGGCCAACCTCCTCTTCAAAGGCTCTGTGGATAGCAACTGG
ATCGTGGGTGCCACGCTGGAGAAGAAGCTCCCACCCCTGCCCCTGACACTGGCCCTTGGGGCCTTCCTG
AATCACCGCAAGAACAAGTTTCAGTGTGGCTTTGGCCTCACCATCGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001128917
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001128917.1
RefSeq Size 1819 bp
RefSeq ORF 1086 bp
Locus ID 10452
UniProt ID O96008
Cytogenetics 19q13.32
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Amyotrophic lateral sclerosis (ALS)
MW 37.9 kDa
Summary The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1-3 encode the same protein.
Write Your Own Review
You're reviewing:TOMM40 (NM_001128917) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225543 TOMM40 (Myc-DDK-tagged)-Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$457.00
RC225543L1 Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC225543L2 Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$757.00
RC225543L3 Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC225543L4 Lenti ORF clone of Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$757.00
RG225543 TOMM40 (tGFP-tagged) - Human translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.