ABIN3 (TNIP3) (NM_001128843) Human Untagged Clone

SKU
SC322975
TNIP3 (untagged)-Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ABIN3
Synonyms ABIN-3; LIND
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC322975 representing NM_001128843.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACAAAAATGAGAAACACGACGATAAACTGGTAATGTTCACCAATCAATCTGAAGATTCTGAAAGA
TGTGAAAGCATGGAGCTGGACAAAAAAATCCAGGATCTGATTGAGAGAAATGCGTCTCCTCATCCAAAA
CGGTTCACCCCAGAGGCCATGCCAACTCACAGAAATCTATGTTCTCTGAAGACTCCAGGAAAAACAGCT
TCCATGGCACATTTTGTACAGGGCACATCTAGAATGATTGCCGCAGAAAGTTCTACGGAGCATAAAGAG
TGTGCTGAACCATCAACAAGAAAGAACTTGATGAATTCTCTTGAACAAAAGATAAGGTGTTTGGAAAAA
CAAAGAAAAGAGCTCCTGGAAGTTAACCAGCAATGGGATCAGCAATTTAGAAGTATGAAAGAGTTATAT
GAAAGAAAGGTAGCAGAGCTGAAGACGAAACTGGACGCCGCGGAAAGATTCCTCAGCACGCGGGAGAAG
GATCCGCATCAGAGGCAGAGAAAGGACGACAGGCAGAGAGAGGACGACAGGCAGCGCGACCTGACCCGG
GACCGGCTGCAGCGGGAGGAGAAGGAAAAGGAACGCCTAAATGAAGAATTACATGAATTGAAAGAAGAG
AATAAACTTTTAAAGGGAAAAAATACTCTTGCGAACAAGGAAAAGGAACATTACGAATGTGAAATAAAA
CGCCTCAATAAGGCTCTTCAGGATGCCTTGAATATCAAGTGTTCATTTTCCGAGGACTGTTTGAGGAAG
TCTCGAGTGGAATTCTGCCATGAGGAGATGAGAACAGAAATGGAAGTTCTGAAGCAGCAGGTGCAAATA
TACGAAGAAGACTTCAAAAAGGAACGATCGGATCGAGAGAGACTTAATCAAGAGAAAGAGGAGCTACAG
CAAATTAATGAAACTTCCCAATCCCAGTTGAACAGGCTGAATTCCCAGATAAAAGCTTGTCAGATGGAG
AAAGAAAAACTAGAAAAGCAATTAAAACAGATGTATTGCCCACCCTGTAACTGCGGCTTGGTTTTCCAC
CTGCAAGATCCATGGGTACCAACAGGCCCTGGAGCTGTGCAGAAGCAACGGGAGCACCCAGTTTATCCT
CAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001128843
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001128843.2
RefSeq Size 2410 bp
RefSeq ORF 1110 bp
Locus ID 79931
UniProt ID Q96KP6
Cytogenetics 4q27
MW 44.1 kDa
Summary Binds to zinc finger protein TNFAIP3 and inhibits NF-kappa-B activation induced by tumor necrosis factor, Toll-like receptor 4 (TLR4), interleukin-1 and 12-O-tetradecanoylphorbol-13-acetate. Overexpression inhibits NF-kappa-B-dependent gene expression in response to lipopolysaccharide at a level downstream of TRAF6 and upstream of IKBKB. NF-kappa-B inhibition is independent of TNFAIP3 binding.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and initiates translation at an alternate start codon, and lacks an exon in the 3' coding region which results in a frameshift compared to variant 1. The encoded protein (isoform 2) has distinct N- and C-termini and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:ABIN3 (TNIP3) (NM_001128843) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225469 TNIP3 (Myc-DDK-tagged)-Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2 10 ug
$300.00
RC225469L1 Lenti ORF clone of Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC225469L2 Lenti ORF clone of Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2, mGFP tagged 10 ug
$600.00
RC225469L3 Lenti ORF clone of Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC225469L4 Lenti ORF clone of Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2, mGFP tagged 10 ug
$600.00
RG225469 TNIP3 (tGFP-tagged) - Human TNFAIP3 interacting protein 3 (TNIP3), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.