SLC25A19 (NM_001126122) Human Untagged Clone

SKU
SC322973
SLC25A19 (untagged)-Human solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 (SLC25A19), nuclear gene encoding mitochondrial protein, transcript variant 3
$330.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLC25A19
Synonyms DNC; MCPHA; MUP1; THMD3; THMD4; TPC
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001126122, the custom clone sequence may differ by one or more nucleotides
ATGGTTGGCTATGACCCCAAACCAGATGGCAGGAATAACACCAAGTTCCAGGTGGCAGTG
GCTGGGTCTGTGTCTGGACTTGTTACTCGGGCGCTGATCAGTCCCTTCGACGTCATCAAG
ATCCGTTTCCAGCTTCAGCATGAGCGCCTGTCTCGCAGTGACCCCAGCGCAAAGTACCAT
GGCATCCTCCAGGCCTCTAGGCAGATTCTGCAGGAGGAGGGTCCGACAGCTTTCTGGAAA
GGACACGTCCCAGCTCAGATTCTCTCCATAGGCTATGGAGCTGTCCAATTCTTGTCATTT
GAAATGCTGACGGAGCTGGTCCACAGAGGCAGCGTGTATGACGCCCGGGAATTCTCAGTG
CACTTTGTATGTGGTGGCCTGGCTGCCTGTATGGCCACCCTCACTGTGCACCCCGTGGAT
GTTCTGCGCACCCGCTTTGCAGCTCAGGGTGAGCCCAAGGTCTATAATACGCTGCGCCAC
GCCGTGGGGACCATGTATAGGAGCGAAGGCCCCCAGGTTTTCTACAAAGGCTTGGCTCCC
ACCTTGATCGCCATCTTCCCCTACGCCGGGCTGCAGTTCTCTTGCTACAGCTCCTTGAAG
CACCTGTACAAGTGGGCCATACCAGCCGAAGGAAAGAAAAATGAGAACCTCCAAAACCTG
CTTTGTGGCAGTGGAGCTGGTGTCATCAGCAAGACCCTGACATATCCGCTGGACCTCTTC
AAGAAGCGGCTACAGGTTGGAGGGTTTGAGCATGCCAGAGCTGCCTTTGGCCAGGTACGG
AGATACAAGGGCCTCATGGACTGTGCCAAGCAGGTGCTGCAAAAGGAAGGCGCCCTGGGC
TTCTTCAAGGGCCTGTCCCCCAGCTTGCTGAAGGCTGCCCTCTCCACAGGCTTCATGTTC
TTCTCGTATGAATTCTTCTGTAATGTCTTCCACTGCATGAACAGGACAGCCAGCCAGCGC
Restriction Sites Please inquire
ACCN NM_001126122
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001126122.1, NP_001119594.1
RefSeq Size 1585 bp
RefSeq ORF 963 bp
Locus ID 60386
UniProt ID Q9HC21
Cytogenetics 17q25.1
Protein Families Druggable Genome
Summary This gene encodes a mitochondrial protein that is a member of the solute carrier family. Although this protein was initially thought to be the mitochondrial deoxynucleotide carrier involved in the uptake of deoxynucleotides into the matrix of the mitochondria, further studies have demonstrated that this protein instead functions as the mitochondrial thiamine pyrophosphate carrier, which transports thiamine pyrophosphates into mitochondria. Mutations in this gene cause microcephaly, Amish type, a metabolic disease that results in severe congenital microcephaly, severe 2-ketoglutaric aciduria, and death within the first year. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
Write Your Own Review
You're reviewing:SLC25A19 (NM_001126122) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225460 SLC25A19 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 (SLC25A19), nuclear gene encoding mitochondrial protein, transcript variant 10 ug
$330.00
RC225460L3 Lenti-ORF clone of SLC25A19 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 (SLC25A19), nuclear gene encoding mitochondrial protein, transcript variant 10 ug
$630.00
RC225460L4 Lenti-ORF clone of SLC25A19 (mGFP-tagged)-Human solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 (SLC25A19), nuclear gene encoding mitochondrial protein, transcript variant 10 ug
$630.00
RG225460 SLC25A19 (tGFP-tagged) - Human solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 (SLC25A19), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.