RRAD (NM_001128850) Human Untagged Clone

SKU
SC322965
RRAD (untagged)-Human Ras-related associated with diabetes (RRAD), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RRAD
Synonyms RAD; RAD1; REM3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC322965 representing NM_001128850.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCTGAACGGCGGCGGCAGCGGAGCGGGCGGGAGCCGCGGTGGGGGCCAGGAGCGCGAGCGCCGT
CGGGGCAGCACACCCTGGGGCCCCGCCCCGCCGCTGCACCGCCGCAGCATGCCGGTGGACGAGCGCGAC
CTGCAGGCGGCGCTGACCCCGGGTGCCCTGACGGCGGCCGCGGCCGGGACGGGGACCCAGGGTCCCAGG
CTGGACTGGCCCGAGGACTCCGAGGACTCGCTCAGCTCAGGGGGCAGCGACTCAGACGAGAGCGTTTAC
AAGGTGCTGCTGCTGGGGGCGCCCGGCGTGGGCAAGAGCGCCCTGGCGCGCATCTTCGGCGGTGTGGAG
GACGGGCCTGAAGCAGAGGCAGCAGGGCACACCTATGATCGCTCCATTGTAGTGGACGGAGAAGAGGCA
TCACTCATGGTCTACGACATTTGGGAGCAGGACGGGGGCCGCTGGTTGCCCGGCCACTGCATGGCCATG
GGGGATGCCTATGTCATTGTGTACTCAGTGACGGACAAGGGCAGCTTCGAGAAGGCCTCAGAACTGCGG
GTCCAGCTGCGGCGTGCACGGCAAACAGATGATGTGCCCATCATCCTCGTGGGCAACAAGAGCGACCTG
GTGCGCTCTCGTGAGGTCTCGGTGGATGAGGGCCGGGCCTGCGCGGTGGTCTTTGACTGCAAGTTCATT
GAGACATCAGCGGCATTGCACCACAATGTCCAGGCGCTGTTTGAAGGTGTCGTGCGCCAGATACGCCTG
CGCAGGGACAGCAAAGAAGCCAACGCACGACGGCAAGCAGGCACCCGGAGGCGAGAGAGCCTTGGCAAA
AAGGCGAAGCGCTTCTTGGGCCGCATCGTAGCTCGTAACAGCCGCAAGATGGCCTTTCGCGCCAAATCC
AAGTCCTGCCACGACCTCTCGGTTCTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001128850
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001128850.1
RefSeq Size 1476 bp
RefSeq ORF 927 bp
Locus ID 6236
UniProt ID P55042
Cytogenetics 16q22.1
MW 33.2 kDa
Summary May play an important role in cardiac antiarrhythmia via the strong suppression of voltage-gated L-type Ca(2+) currents. Regulates voltage-dependent L-type calcium channel subunit alpha-1C trafficking to the cell membrane (By similarity). Inhibits cardiac hypertrophy through the calmodulin-dependent kinase II (CaMKII) pathway. Inhibits phosphorylation and activation of CAMK2D.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.
Write Your Own Review
You're reviewing:RRAD (NM_001128850) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225433 RRAD (Myc-DDK-tagged)-Human Ras-related associated with diabetes (RRAD), transcript variant 1 10 ug
$300.00
RC225433L1 Lenti ORF clone of Human Ras-related associated with diabetes (RRAD), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC225433L2 Lenti ORF clone of Human Ras-related associated with diabetes (RRAD), transcript variant 1, mGFP tagged 10 ug
$600.00
RC225433L3 Lenti ORF clone of Human Ras-related associated with diabetes (RRAD), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC225433L4 Lenti ORF clone of Human Ras-related associated with diabetes (RRAD), transcript variant 1, mGFP tagged 10 ug
$600.00
RG225433 RRAD (tGFP-tagged) - Human Ras-related associated with diabetes (RRAD), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.