SPG21 (NM_001127889) Human Untagged Clone

SKU
SC322963
SPG21 (untagged)-Human spastic paraplegia 21 (autosomal recessive, Mast syndrome) (SPG21), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SPG21
Synonyms ABHD21; ACP33; BM-019; GL010; MAST
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC322963 representing NM_001127889.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGAGATTAAAGTCTCTCCTGATTATAACTGGTTTAGAGGTACAGTTCCCCTTAAAAAGATTATT
GTGGATGATGATGACAGTAAGATATGGTCGCTCTATGACGCGGGCCCCCGAAGTATCAGGTGTCCTCTC
ATATTCCTGCCCCCTGTCAGTGGAACTGCAGATGTCTTTTTCCGGCAGATTTTGGCTCTGACTGGATGG
GGTTACCGGGTTATCGCTTTGCAGTATCCAGTTTATTGGGACCATCTCGAGTTCTGTGATGGATTCAGA
AAACTTTTAGACCATTTACAATTGGATAAAGTTCATCTTTTTGGCGCTTCTTTGGGAGGCTTTTTGGCC
CAGAAATTTGCTGAATACACTCACAAATCTCCTAGAGTCCATTCCCTAATCCTCTGCAATTCCTTCAGT
GACACCTCTATCTTCAACCAAACTTGGACTGCAAACAGCTTTTGGCTGATGCCTGCATTTATGCTCAAA
AAAATAGTTCTTGGAAATTTTTCATCTGGCCCGGTGGACCCTATGATGGCTGATGCCATTGATTTCATG
GTAGACAGGCTAGAAAGTTTGGGTCAGAGTGAACTGGCTTCAAGACTTACCTTGAATTGTCAAAATTCT
TATGTGGAACCTCATAAAATTCGGGACATACCTGTAACTATTATGGATGTGTTTGATCAGAGTGCGCTT
TCAACTGAAGCTAAAGAAGAAATGTACAAGCTGTATCCTAATGCCCGAAGAGCTCATCTGAAAACAGGA
GGCAATTTCCCATACCTGTGCAGAAGTGCAGAGGTCAATCTTTATGTACAGATACATTTGCTGCAATTC
CATGGAACCAAATACGCGGCCATTGACCCATCAATGGTCAGTGCCGAGGAGCTTGAGGTGCAGAAAGGC
AGCCTTGGCATCAGCCAGGAGGAGCAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001127889
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001127889.4
RefSeq Size 1658 bp
RefSeq ORF 927 bp
Locus ID 51324
UniProt ID Q9NZD8
Cytogenetics 15q22.31
MW 35 kDa
Summary The protein encoded by this gene binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation. The interaction with CD4 is mediated by the noncatalytic alpha/beta hydrolase fold domain of this protein. It is thus proposed that this gene product modulates the stimulatory activity of CD4. Mutations in this gene are associated with autosomal recessive spastic paraplegia 21 (SPG21), also known as mast syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (a).
Write Your Own Review
You're reviewing:SPG21 (NM_001127889) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225431 SPG21 (Myc-DDK-tagged)-Human spastic paraplegia 21 (autosomal recessive, Mast syndrome) (SPG21), transcript variant 2 10 ug
$300.00
RC225431L3 Lenti ORF clone of Human spastic paraplegia 21 (autosomal recessive, Mast syndrome) (SPG21), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC225431L4 Lenti ORF clone of Human spastic paraplegia 21 (autosomal recessive, Mast syndrome) (SPG21), transcript variant 2, mGFP tagged 10 ug
$600.00
RG225431 SPG21 (tGFP-tagged) - Human spastic paraplegia 21 (autosomal recessive, Mast syndrome) (SPG21), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.