PEX26 (NM_001127649) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PEX26 |
Synonyms | PBD7A; PBD7B; PEX26M1T; Pex26pM1T |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC322962 representing NM_001127649.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGAGCGATTCTTCGACCTCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGCGCAGCAGCGAG CCGGTGCGCGCGGTCCCGGCCCGGGCGCCGGCCGTGGACCTTCTGGAGGAGGCGGCCGACCTCCTGGTG GTGCACCTGGACTTCCGGGCGGCGCTGGAGACCTGCGAGCGGGCCTGGCAGAGTCTGGCCAACCACGCC GTGGCAGAGGAACCCGCGGGCACCTCATTGGAGGTGAAGTGCTCCCTGTGTGTTGTGGGGATCCAGGCC CTGGCAGAAATGGATCGGTGGCAAGAAGTCCTCTCCTGGGTCCTTCAGTATTACCAGGTCCCTGAAAAG CTACCCCCCAAAGTCCTGGAGCTGTGCATTCTTTTATACAGCAAAATGCAAGAGCCTGGAGCTGTGCTG GATGTGGTGGGTGCCTGGCTCCAAGACCCAGCCAATCAAAACCTTCCAGAATATGGAGCCTTGGCAGAA TTTCACGTGCAGCGGGTGCTGCTGCCTCTGGGCTGCTTATCGGAGGCTGAGGAGCTAGTGGTGGGCTCT GCAGCCTTTGGTGAGGAGCGGCGACTGGATGTACTTCAGGCCATTCACACAGCGAGGCAGCAGCAGAAA CAGGAACACTCAGGCTCTGAGGAGGCCCAGAAGCCAAACCTGGAAGGCTCTGTCTCCCACAAGTTCCTG TCACTACCGATGTTGGTTCGCCAGCTTTGGGACTCTGCGGTGAGCCACTTCTTTTCTCTGCCCTTCAAA AAGAGTCTCCTGGCTGCCTTGATCCTCTGTCTCCTGGTGGTGAGATTTGATCCAGCTTCCCCTTCCTCC CTGCACTTCCTCTACAAGCTGGCCCAGCTCTTCCGCTGGATCCGGAAGGCTGCATTTTCTCGCCTCTAC CAGCTCCGCATCCGTGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127649 |
Insert Size | 918 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001127649.2 |
RefSeq Size | 4267 bp |
RefSeq ORF | 918 bp |
Locus ID | 55670 |
UniProt ID | Q7Z412 |
Cytogenetics | 22q11.21 |
MW | 33.9 kDa |
Summary | This gene belongs to the peroxin-26 gene family. It is probably required for protein import into peroxisomes. It anchors PEX1 and PEX6 to peroxisome membranes, possibly to form heteromeric AAA ATPase complexes required for the import of proteins into peroxisomes. Defects in this gene are the cause of peroxisome biogenesis disorder complementation group 8 (PBD-CG8). PBD refers to a group of peroxisomal disorders arising from a failure of protein import into the peroxisomal membrane or matrix. The PBD group is comprised of four disorders: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC225429 | PEX26 (Myc-DDK-tagged)-Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2 | 10 ug |
$300.00
|
|
RC225429L3 | Lenti ORF clone of Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC225429L4 | Lenti ORF clone of Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG225429 | PEX26 (tGFP-tagged) - Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.