PEX26 (NM_001127649) Human Untagged Clone

SKU
SC322962
PEX26 (untagged)-Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PEX26
Synonyms PBD7A; PBD7B; PEX26M1T; Pex26pM1T
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC322962 representing NM_001127649.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGAGCGATTCTTCGACCTCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGCGCAGCAGCGAG
CCGGTGCGCGCGGTCCCGGCCCGGGCGCCGGCCGTGGACCTTCTGGAGGAGGCGGCCGACCTCCTGGTG
GTGCACCTGGACTTCCGGGCGGCGCTGGAGACCTGCGAGCGGGCCTGGCAGAGTCTGGCCAACCACGCC
GTGGCAGAGGAACCCGCGGGCACCTCATTGGAGGTGAAGTGCTCCCTGTGTGTTGTGGGGATCCAGGCC
CTGGCAGAAATGGATCGGTGGCAAGAAGTCCTCTCCTGGGTCCTTCAGTATTACCAGGTCCCTGAAAAG
CTACCCCCCAAAGTCCTGGAGCTGTGCATTCTTTTATACAGCAAAATGCAAGAGCCTGGAGCTGTGCTG
GATGTGGTGGGTGCCTGGCTCCAAGACCCAGCCAATCAAAACCTTCCAGAATATGGAGCCTTGGCAGAA
TTTCACGTGCAGCGGGTGCTGCTGCCTCTGGGCTGCTTATCGGAGGCTGAGGAGCTAGTGGTGGGCTCT
GCAGCCTTTGGTGAGGAGCGGCGACTGGATGTACTTCAGGCCATTCACACAGCGAGGCAGCAGCAGAAA
CAGGAACACTCAGGCTCTGAGGAGGCCCAGAAGCCAAACCTGGAAGGCTCTGTCTCCCACAAGTTCCTG
TCACTACCGATGTTGGTTCGCCAGCTTTGGGACTCTGCGGTGAGCCACTTCTTTTCTCTGCCCTTCAAA
AAGAGTCTCCTGGCTGCCTTGATCCTCTGTCTCCTGGTGGTGAGATTTGATCCAGCTTCCCCTTCCTCC
CTGCACTTCCTCTACAAGCTGGCCCAGCTCTTCCGCTGGATCCGGAAGGCTGCATTTTCTCGCCTCTAC
CAGCTCCGCATCCGTGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001127649
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001127649.2
RefSeq Size 4267 bp
RefSeq ORF 918 bp
Locus ID 55670
UniProt ID Q7Z412
Cytogenetics 22q11.21
MW 33.9 kDa
Summary This gene belongs to the peroxin-26 gene family. It is probably required for protein import into peroxisomes. It anchors PEX1 and PEX6 to peroxisome membranes, possibly to form heteromeric AAA ATPase complexes required for the import of proteins into peroxisomes. Defects in this gene are the cause of peroxisome biogenesis disorder complementation group 8 (PBD-CG8). PBD refers to a group of peroxisomal disorders arising from a failure of protein import into the peroxisomal membrane or matrix. The PBD group is comprised of four disorders: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PEX26 (NM_001127649) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225429 PEX26 (Myc-DDK-tagged)-Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2 10 ug
$300.00
RC225429L3 Lenti ORF clone of Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC225429L4 Lenti ORF clone of Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2, mGFP tagged 10 ug
$600.00
RG225429 PEX26 (tGFP-tagged) - Human peroxisomal biogenesis factor 26 (PEX26), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.