Cytochrome b reductase 1 (CYBRD1) (NM_001127383) Human Untagged Clone

SKU
SC322853
CYBRD1 (untagged)-Human cytochrome b reductase 1 (CYBRD1), transcript variant 2
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cytochrome b reductase 1
Synonyms CYB561A2; DCYTB; FRRS3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC322853 representing NM_001127383.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCATGGAGGGCTACTGGCGCTTCCTGGCGCTGCTGGGGTCGGCACTGCTCGTCGGCTTCCTGTCG
GTGATCTTCGCCCTCGTCTGGGTCCTCCACTACCGAGAGGGGCTTGGCTGGGATGGGAGCGCACTAGAG
TTTAACTGGCACCCAGTGCTCATGGTCACCGGCTTCGTCTTCATCCAGGGCATCGCTTCTTTCAGGTTT
TTCAGTCTTTCTGCTTCCATGGGCTCCGCTTTCTCTCCGAGCATTTCTCATGCCCATACATGTTTATTC
TGGAATTGTCATCTTTGGAACAGTGATTGCAACAGCACTTATGGGATTGACAGAGAAACTGATTTTTTC
CCTGAGAGATCCTGCATACAGTACATTCCCGCCAGAAGGTGTTTTCGTAAATACGCTTGGCCTTCTGAT
CCTGGTGTTCGGGGCCCTCATTTTTTGGATAGTCACCAGACCGCAATGGAAACGTCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001127383
Insert Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001127383.1
RefSeq Size 4153 bp
RefSeq ORF 474 bp
Locus ID 79901
UniProt ID Q53TN4
Cytogenetics 2q31.1
Protein Families Transmembrane
MW 17.9 kDa
Summary This gene is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorption. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate exon that results in a frameshift in the central and 3' coding regions, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:Cytochrome b reductase 1 (CYBRD1) (NM_001127383) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225139 CYBRD1 (Myc-DDK-tagged)-Human cytochrome b reductase 1 (CYBRD1), transcript variant 2 10 ug
$150.00
RC225139L1 Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC225139L2 Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, mGFP tagged 10 ug
$450.00
RC225139L3 Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC225139L4 Lenti ORF clone of Human cytochrome b reductase 1 (CYBRD1), transcript variant 2, mGFP tagged 10 ug
$450.00
RG225139 CYBRD1 (tGFP-tagged) - Human cytochrome b reductase 1 (CYBRD1), transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.