TBX21 (NM_013351) Human Untagged Clone

CAT#: SC322597

Reviews ()
Write a review

TBX21 (untagged)-Human T-box 21 (TBX21)



  "NM_013351" in other vectors (7)

Reconstitution Protocol

USD 748.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "TBX21"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TBX21
Synonyms T-bet; T-PET; TBET; TBLYM
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_013351 edited
GGACGCGTGGGCGAGGGCGTAGAAGCCAGGCGTCAGAGCCCGGGCTCCGGTGGGGTCCCC
CACCCGGCCCTCGGGTCCCCCGCCCCCTGCTCCCTGCCCATCCCAGCCCACGCGACCCTC
TCGCGCGCGGAGGGGCGGGTCCTCGACGGCTACGGGAAGGTGCCAGCCCGCCCCGGATGG
GCATCGTGGAGCCGGGTTGCGGAGACATGCTGACGGGCACCGAGCCGATGCCGGGGAGCG
ACGAGGGCCGGGCGCCTGGCGCCGACCCGCAGCACCGCTACTTCTACCCGGAGCCGGGCG
CGCAGGACGCGGACGAGCGTCGCGGGGGCGGCAGCCTGGGGTCTCCCTACCCGGGGGGCG
CCTTGGTGCCCGCCCCGCCGAGCCGCTTCCTTGGAGCCTACGCCTACCCGCCGCGACCCC
AGGCGGCCGGCTTCCCCGGCGCGGGCGAGTCCTTCCCGCCGCCCGCGGACGCCGAGGGCT
ACCAGCCGGGCGAGGGCTACGCCGCCCCGGACCCGCGCGCCGGGCTCTACCCGGGGCCGC
GTGAGGACTACGCGCTACCCGCGGGACTGGAGGTGTCGGGGAAACTGAGGGTCGCGCTCA
ACAACCACCTGTTGTGGTCCAAGTTTAATCAGCACCAGACAGAGATGATCATCACCAAGC
AGGGACGGCGGATGTTCCCATTCCTGTCATTTACTGTGGCCGGGCTGGAGCCCACCAGCC
ACTACAGGATGTTTGTGGACGTGGTCTTGGTGGACCAGCACCACTGGCGGTACCAGAGCG
GCAAGTGGGTGCAGTGTGGAAAGGCCGAGGGCAGCATGCCAGGAAACCGCCTGTACGTCC
ACCCGGACTCCCCCAACACAGGAGCGCACTGGATGCGCCAGGAAGTTTCATTTGGGAAAC
TAAAGCTCACAAACAACAAGGGGGCGTCCAACAATGTGACCCAGATGATTGTGCTCCAGT
CCCTCCATAAGTACCAGCCCCGGCTGCATATCGTTGAGGTGAACGACGGAGAGCCAGAGG
CAGCCTGCAACGCTTCCAACACGCATATCTTTACTTTCCAAGAAACCCAGTTCATTGCCG
TGACTGCCTACCAGAATGCCGAGATTACTCAGCTGAAAATTGATAATAACCCCTTTGCCA
AAGGATTCCGGGAGAACTTTGAGTCCATGTACACATCTGTTGACACCAGCATCCCCTCCC
CGCCTGGACCCAACTGTCAATTCCTTGGGGGAGATCACTACTCTCCTCTCCTACCCAACC
AGTATCCTGTTCCCAGCCGCTTCTACCCCGACCTTCCTGGCCAGGCGAAGGATGTGGTTC
CCCAGGCTTACTGGCTGGGGGCCCCCCGGGACCACAGCTATGAGGCTGAGTTTCGAGCAG
TCAGCATGAAGCCTGCATTCTTGCCCTCTGCCCCTGGGCCCACCATGTCCTACTACCGAG
GCCAGGAGGTCCTGGCACCTGGAGCTGGCTGGCCTGTGGCACCCCAGTACCCTCCCAAGA
TGGGCCCGGCCAGCTGGTTCCGCCCTATGCGGACTCTGCCCATGGAACCCGGCCCTGGAG
GCTCAGAGGGACGGGGACCAGAGGACCAGGGTCCCCCCTTGGTGTGGACTGAGATTGCCC
CCATCCGGCCGGAATCCAGTGATTCAGGACTGGGCGAAGGAGACTCTAAGAGGAGGCGCG
TGTCCCCCTATCCTTCCAGTGGTGACAGCTCCTCCCCTGCTGGGGCCCCTTCTCCTTTTG
ATAAGGAAGCTGAAGGACAGTTTTATAACTATTTTCCCAACTGAGCAGATGACATGATGA
AAGGAACAGAAACAGTGTTATTAGGTTGGAGGACACCGACTAATTTGGGAAACGGATGAA
GGACTGAGAAGGCCCCCGCTCCCTCTGGCCCTTCTCTGTTTAGTAGTTGGTTGGGGAAGT
GGGGCTCAAGAAGGATTTTGGGGTTCACCAGATGCTTCCTGGCCCACGATGAAACCTGAG
AGGGGTGTCCCCTTGCCCCATCCTCTGCCCTAACTACAGTCGTTTACCTGGTGCTGCGTC
TTGCTTTTGGTTTCCAGCTGGAGAAAAGAAGACAAGAAAGTCTTGGGCATGAAGGAGCTT
TTTGCATCTAGTGGGTGGGAGGGGTCAGGTGTGGGACATGGGAGCAGGAGACTCCACTTT
CTTCCTTTGTACAGTAACTTTCAACCTTTTCGTTGGCATGTGTGTTAATCCCTGATCCAA
AAAGAACAAATACACGTATGTTATAACCATCAGCCCGCCAGGGTCAGGGAAAGGACTCAC
CTGACTTTGGACAGCTGGCCTGGGCTCCCCCTGCTCAAACACAGTGGGGATCAGAGAAAA
GGGGCTGGAAAGGGGGGAATGGCCCACATCTCAAGAAGCAAGATATTGTTTGTGGTGGTT
GTGTGTGGGTGTGTGTTTTTTCTTTTTCTTTCTTTTTATTTTTTTTGAATGGGGGAGGCT
ATTTATTGTACTGAGAGTGGTGTCTGGATATATTCCTTTTGTCTTCATCACTTTCTGAAA
ATAAACATAAAACTGTTAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_013351
Insert Size 2600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013351.1, NP_037483.1
RefSeq Size 2589 bp
RefSeq ORF 1608 bp
Locus ID 30009
UniProt ID Q9UL17
Cytogenetics 17q21.32
Domains T-box
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008]

Other Versions

Frequently bought together (4)
Rabbit Polyclonal TBX21 Antibody
    • 100 ug

USD 528.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.