ARL8A (NM_138795) Human Untagged Clone

SKU
SC322460
ARL8A (untagged)-Human ADP-ribosylation factor-like 8A (ARL8A)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ARL8A
Synonyms ARL10B; GIE2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322460 CGGGACCCGGGCCGTACCGGGGAGGGGCCGCTCCGGGCCGCAGCGCGAGGGCAGCGAGGG
GCGGCGGGGACCTGGCACCGGGCGGGGCCGGCGGCAGCGACCATGATCGCTTTGTTCAAC
AAGCTGCTGGACTGGTTCAAGGCCCTATTCTGGAAGGAGGAGATGGAGCTCACGCTGGTC
GGGCTTCAGTACTCGGGCAAGACCACCTTCGTCAACGTGATCGCGTCAGGACAGTTCAAC
GAGGACATGATCCCCACCGTGGGTTTCAACATGCGCAAAATCACCAAAGGGAATGTGACT
ATCAAGCTCTGGGACATTGGGGGACAGCCGCGTTTCCGCAGCATGTGGGAGCGCTACTGC
CGAGGAGTGAGCGCCATCGTGTACATGGTGGATGCTGCTGACCAGGAGAAGATTGAGGCC
TCTAAGAACGAGCTCCACAACCTACTGGACAAACCTCAGCTGCAGGGCATCCCGGTCTTA
GTCCTGGGTAACAAGCGAGACCTTCCGGGAGCATTGGATGAGAAGGAGCTGATTGAGAAA
ATGAATCTGTCTGCCATCCAGGACCGAGAGATCTGCTGCTACTCCATCTCTTGCAAAGAA
AAGGACAACATTGACATCACCCTACAGTGGCTTATTCAACACTCGAAGTCACGGAGAAGC
TGAGACTCCAGCCCTTCTCCCTCAGACCAGGGACCGTCATCATCTAAACCTGAAGCCGAG
CTCCCCGCCCACCCCTGTCGTCCCCCTAAGCCCACCCCTCCTCACCCAGTGTGAGGAGGG
CCCTCTGGGGACCCCAGAGTCCTGTTCTGCTGAGGTTTGAACTCCTGTTTTTATTGTAAA
ATAAATTGCCCCCCATTCTGGTCCCCTAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_138795
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138795.2, NP_620150.1
RefSeq Size 2345 bp
RefSeq ORF 561 bp
Locus ID 127829
UniProt ID Q96BM9
Cytogenetics 1q32.1
Domains arf, ARF, RAB, SAR
Summary Plays a role in lysosome motility (By similarity). In neurons, mediates the anterograde axonal long-range transport of presynaptic lysosome-related vesicles required for presynaptic biogenesis and synaptic function (By similarity). May play a role in chromosome segregation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:ARL8A (NM_138795) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204596 ARL8A (Myc-DDK-tagged)-Human ADP-ribosylation factor-like 8A (ARL8A) 10 ug
$300.00
RC204596L1 Lenti ORF clone of Human ADP-ribosylation factor-like 8A (ARL8A), Myc-DDK-tagged 10 ug
$600.00
RC204596L2 Lenti ORF clone of Human ADP-ribosylation factor-like 8A (ARL8A), mGFP tagged 10 ug
$600.00
RC204596L3 Lenti ORF clone of Human ADP-ribosylation factor-like 8A (ARL8A), Myc-DDK-tagged 10 ug
$600.00
RC204596L4 Lenti ORF clone of Human ADP-ribosylation factor-like 8A (ARL8A), mGFP tagged 10 ug
$600.00
RG204596 ARL8A (tGFP-tagged) - Human ADP-ribosylation factor-like 8A (ARL8A) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC108118 ARL8A (untagged)-Human ADP-ribosylation factor-like 8A (ARL8A) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.