IKB beta (NFKBIB) (NM_002503) Human Untagged Clone
SKU
SC322444
NFKBIB (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | IKB beta |
Synonyms | IKBB; TRIP9 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for SC322444
GCGACTGCGGGGGGCCCCTGAGGCGGCGGGGGCCATGGCTGGGGTCGCGTGCTTGGGAAA
AGCTGCCGACGCAGATGAATGGTGCGACAGCGGCCTGGGCTCCCTGGGTCCGGACGCAGC GGCCCCCGGAGGACCTGGGTTGGGCGCGGAGTTGGGCCCGGGGCTGTCGTGGGCTCCCCT CGTCTTCGGCTACGTCACTGAGGATGGGGACACGGCACTGCACTTGGCTGTGATTCATCA GCATGAACCCTTCCTGGATTTTCTTCTAGGCTTCTCGGCCGGCACTGAGTACATGGACCT GCAGAATGACCTAGGCCAGACAGCCCTGCACCTGGCAGCCATCCTGGGGGAGACATCCAC GGTGGAGAAGCTGTACGCAGCAGGCGCCGGGCTGTGTGTGGCGGAGCGTAGGGGCCACAC GGCGCTGCACCTGGCCTGCCGTGTGGGGGCACACGCCTGTGCCCGTGCCCTGCTTCAGCC CCGCCCCCGGCGCCCCAGGGAAGCCCCCGACACCTACCTCGCTCAGGGCCCTGACCGTAC TCCCGACACCAACCATACCCCTGTCGCCTTGTACCCCGATTCCGACTTGGAGAAGGAAGA AGAGGAGAGTGAGGAGGACTGGAAGCTGCAGCTGGAGGCTGAAAACTACGAGGGCCACAC CCCACTCCACGTGGCCGTTATCCACAAAGATGTGGAGATGGTCCGGCTGCTCCGAGATGC TGGAGCTGACCTTGACAAACCGGAGCCCACGTGCGGCCGGAGCCCCCTTCATTTGGCAGT GGAGGCCCAGGCAGCCGATGTGCTGGAGCTTCTCCTGAGGGCAGGCGCGAACCCTGCTGC CCGCATGTACGGTGGCCGCACCCCACTCGGCAGTGCCATGCTCCGGCCCAACCCCATCCT CGCCCGCCTCCTCCGTGCACACGGAGCCCCTGAGCCCGAGGGCGAGGACGAGAAATCCGG CCCCTGCAGCAGCAGTAGCGACAGCGACAGCGGAGACGAGGGCGATGAATACGACGACAT TGTGGTTCACAGCAGCCGCAGCCAAACCCGGCTGCCTCCCACCCCAGCCTCAAAACCTCT TCCTGACGACCCCCGCCCCGTGTGATTTGTTTCATTGTTAATATAATTTCCAGTTTAATA AACAAAACCCTAGTTCTGAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002503 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002503.3, NP_002494.2 |
RefSeq Size | 1198 bp |
RefSeq ORF | 1071 bp |
Locus ID | 4793 |
UniProt ID | Q15653 |
Cytogenetics | 19q13.2 |
Domains | ANK |
Protein Families | Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Adipocytokine signaling pathway, B cell receptor signaling pathway, Chemokine signaling pathway, Cytosolic DNA-sensing pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway |
Summary | The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011] Transcript Variant: This variant (1) represents the predominant transcript and encodes the longest isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202182 | NFKBIB (Myc-DDK-tagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1 | 10 ug |
$457.00
|
|
RC202182L1 | Lenti ORF clone of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC202182L2 | Lenti ORF clone of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
RC202182L3 | Lenti ORF clone of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC202182L4 | Lenti ORF clone of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
RG202182 | NFKBIB (tGFP-tagged) - Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
SC118627 | NFKBIB (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1 | 10 ug |
$457.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.