GSTA4 (NM_001512) Human Untagged Clone

CAT#: SC322435

GSTA4 (untagged)-Human glutathione S-transferase alpha 4 (GSTA4)


  "NM_001512" in other vectors (7)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GSTA4 mouse monoclonal antibody, clone OTI3F5 (formerly 3F5)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GSTA4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTA4
Synonyms GSTA4-4; GTA4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322435 AGAAAGCCTGAAAAGCTATCATGGCAGCAAGGCCCAAGCTCCACTATCCCAACGGAAGAG
GCCGGATGGAGTCCGTGAGATGGGTTTTAGCTGCCGCCGGAGTCGAGTTTGATGAAGAAT
TTCTGGAAACAAAAGAACAGTTGTACAAGTTGCAGGATGGTAACCACCTGCTGTTCCAAC
AAGTGCCCATGGTTGAAATTGACGGGATGAAGTTGGTACAGACCCGAAGCATTCTCCACT
ACATAGCAGACAAGCACAATCTCTTTGGCAAGAACCTCAAGGAGAGAACCCTGATTGACA
TGTACGTGGAGGGGACACTGGATCTGCTGGAACTGCTTATCATGCATCCTTTCTTAAAAC
CAGATGATCAGCAAAAGGAAGTGGTTAACATGGCCCAGAAGGCTATAATTAGATACTTTC
CTGTGTTTGAAAAGATTTTAAGGGGTCACGGACAAAGCTTTCTTGTTGGTAATCAGCTGA
GCCTTGCAGATGTGATTTTACTCCAAACCATTTTAGCTCTAGAAGAGAAAATTCCTAATA
TCCTGTCTGCATTTCCTTTCCTCCAGGAATACACAGTGAAACTAAGTAATATCCCTACAA
TTAAGAGATTCCTTGAACCTGGCAGCAAGAAGAAGCCTCCCCCTGATGAAATTTATGTGA
GAACCGTCTACAACATCTTTAGGCCATAAAACAACACATCCATGTGTGAGTGACAGTGTG
TTCCTAGAGATGGTATTGTCTACAGTCATGTCTTAATGGATCCCAGCTCTGTCATGGTGC
TATCTATGTATTAAGTTGGGTCCTAAGTTGGGTCTTTTGTGTCAAAGAGATCATCTCTTC
TAGAAATATCAACCTTTTTTGTCCAGTAAATAATTGTTAGGGGATCTTTATTGGAAAACT
TTTTTGGAGAGGCTGGTATTTAAGTTAGATCTGATTGGGCTACTCATGTCCTGTAGCCAG
TTCATCCTCATAATAAGAATGGGCAGGATCTCTTGTTCTCTCCTGAGTGTCTTTCTACTC
TCCTGAGCGTCTTTCTGCTCTCCTTATCCTGTTCTCTTATCCTTATCCCCTCCAGTCTCT
GCCTAATTTTTAGTGTTTAATAACAACCGAATGTCTAGTAAATGACTCTCCTCTGAGCTG
TAATAAATAAAATGGTAGTAATGAATGCAATCAGTGTTAGCCAAAATAAAGAATTTATGA
GTCATTGAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001512
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001512.2, NP_001503.1
RefSeq Size 1317 bp
RefSeq ORF 669 bp
Locus ID 2941
UniProt ID O15217
Cytogenetics 6p12.2
Domains GST_N, GST_C
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.