Liver Carboxylesterase 1 (CES1) (NM_001025194) Human Untagged Clone

SKU
SC322423
CES1 (untagged)-Human carboxylesterase 1 (CES1), transcript variant 2
$846.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Liver Carboxylesterase 1
Synonyms ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001025194, the custom clone sequence may differ by one or more nucleotides


ATGTGGCTCCGTGCCTTTATCCTGGCCACTCTCTCTGCTTCCGCGGCTTGGGGGCATCCGTCCTCGCCAC
CTGTGGTGGACACCGTGCATGGCAAAGTGCTGGGGAAGTTCGTCAGCTTAGAAGGATTTGCACAGCCTGT
GGCCATTTTCCTGGGAATCCCTTTTGCCAAGCCGCCTCTTGGACCCCTGAGGTTTACTCCACCGCAGCCT
GCAGAACCATGGAGCTTTGTGAAGAATGCCACCTCGTACCCTCCTATGTGCACCCAAGATCCCAAGGCGG
GGCAGTTACTCTCAGAGCTATTTACAAACCGAAAGGAGAACATTCCTCTCAAGCTTTCTGAAGACTGTCT
TTACCTCAATATTTACACTCCTGCTGACTTGACCAAGAAAAACAGGCTGCCGGTGATGGTGTGGATCCAC
GGAGGGGGGCTGATGGTGGGTGCGGCATCAACCTATGATGGGCTGGCCCTTGCTGCCCATGAAAACGTGG
TGGTGGTGACCATTCAATATCGCCTGGGCATCTGGGGATTCTTCAGCACAGGGGATGAACACAGCCGGGG
GAACTGGGGTCACCTGGACCAGGTGGCTGCCCTGCGCTGGGTCCAGGACAACATTGCCAGCTTTGGAGGG
AACCCAGGCTCTGTGACCATCTTTGGAGAGTCAGCGGGAGGAGAAAGTGTCTCTGTTCTTGTTTTGTCTC
CATTGGCCAAGAACCTCTTCCACCGGGCCATTTCTGAGAGTGGCGTGGCCCTCACTTCTGTTCTGGTGAA
GAAAGGTGATGTCAAGCCCTTGGCTGAGCAAATTGCTATCACTGCTGGGTGCAAAACCACCACCTCTGCT
GTCATGGTTCACTGCCTGCGACAGAAGACGGAAGAGGAGCTCTTGGAGACGACATTGAAAATGAAATTCT
TATCTCTGGACTTACAGGGAGACCCCAGAGAGAGTCAACCCCTTCTGGGCACTGTGATTGATGGGATGCT
GCTGCTGAAAACACCTGAAGAGCTTCAAGCTGAAAGGAATTTCCACACTGTCCCCTACATGGTCGGAATT
AACAAGCAGGAGTTTGGCTGGTTGATTCCAATGCAGTTGATGAGCTATCCACTCTCCGAAGGGCAACTGG
ACCAGAAGACAGCCATGTCACTCCTGTGGAAGTCCTATCCCCTTGTTTGCATTGCTAAGGAACTGATTCC
AGAAGCCACTGAGAAATACTTAGGAGGAACAGACGACACTGTCAAAAAGAAAGACCTGTTCCTGGACTTG
ATAGCAGATGTGATGTTTGGTGTCCCATCTGTGATTGTGGCCCGGAACCACAGAGATGCTGGAGCACCCA
CCTACATGTATGAGTTTCAGTACCGTCCAAGCTTCTCATCAGACATGAAACCCAAGACGGTGATAGGAGA
CCACGGGGATGAGCTCTTCTCCGTCTTTGGGGCCCCATTTTTAAAAGAGGGTGCCTCAGAAGAGGAGATC
AGACTTAGCAAGATGGTGATGAAATTCTGGGCCAACTTTGCTCGCAATGGAAACCCCAATGGGGAAGGGC
TGCCCCACTGGCCAGAGTACAACCAGAAGGAAGGGTATCTGCAGATTGGTGCCAACACCCAGGCGGCCCA
GAAGCTGAAGGACAAAGAAGTAGCTTTCTGGACCAACCTCTTTGCCAAGAAGGCAGTGGAGAAGCCACCC
CAGACAGAACACATAGAGCTGTGA


Restriction Sites RsrII-NotI
ACCN NM_001025194
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025194.1, NP_001020365.1
RefSeq Size 2024 bp
RefSeq ORF 1704 bp
Locus ID 1066
UniProt ID P23141
Cytogenetics 16q12.2
Protein Families Druggable Genome
Protein Pathways Drug metabolism - other enzymes
Summary This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) uses a different in-frame splice site at the end of a coding exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter by 1 aa compared to isoform a.
Write Your Own Review
You're reviewing:Liver Carboxylesterase 1 (CES1) (NM_001025194) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202081 CES1 (Myc-DDK-tagged)-Human carboxylesterase 1 (CES1), transcript variant 2 10 ug
$790.00
RC202081L1 Lenti ORF clone of Human carboxylesterase 1 (CES1), transcript variant 2, Myc-DDK-tagged 10 ug
$1,090.00
RC202081L2 Lenti ORF clone of Human carboxylesterase 1 (CES1), transcript variant 2, mGFP tagged 10 ug
$1,090.00
RC202081L3 Lenti ORF clone of Human carboxylesterase 1 (CES1), transcript variant 2, Myc-DDK-tagged 10 ug
$1,090.00
RC202081L4 Lenti ORF clone of Human carboxylesterase 1 (CES1), transcript variant 2, mGFP tagged 10 ug
$1,090.00
RG202081 CES1 (tGFP-tagged) - Human carboxylesterase 1 (CES1), transcript variant 2 10 ug
$990.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.