RAB13 (NM_002870) Human Untagged Clone
CAT#: SC322199
RAB13 (untagged)-Human RAB13, member RAS oncogene family (RAB13)
"NM_002870" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB13 |
Synonyms | GIG4 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322199
CTGGGCTCCGTGCCGCTCTGTTTGCCAACCGTCCAGTCCCGCCTACCAGTGCCGGGCGCT
CCCCACCCCTCCCCCGGCTCCCCCGGTGTCCGCCATGGCCAAAGCCTACGACCACCTCTT CAAGTTGCTGCTGATCGGGGACTCGGGGGTGGGCAAGACTTGTCTGATCATTCGCTTTGC AGAGGACAACTTCAACAACACTTACATCTCCACCATCGGAATTGATTTCAAGATCCGCAC TGTGGATATAGAGGGGAAGAAGATCAAACTACAAGTCTGGGACACGGCTGGCCAAGAGCG GTTCAAGACAATAACTACTGCCTACTACCGTGGAGCCATGGGCATTATCCTAGTATACGA CATCACGGATGAGAAATCTTTCGAGAATATTCAGAACTGGATGAAAAGCATCAAGGAGAA TGCCTCGGCTGGGGTGGAGCGCCTCTTGCTGGGGAACAAATGTGACATGGAGGCCAAGAG GAAGGTGCAGAAGGAGCAGGCCGATAAGTTGGCTCGAGAGCATGGAATCCGATTTTTCGA AACTAGTGCTAAATCCAGTATGAATGTGGATGAGGCTTTTAGTTCCCTGGCCCGGGACAT CTTGCTCAAGTCAGGAGGCCGGAGATCAGGAAACGGCAACAAGCCTCCCAGTACTGACCT GAAAACTTGTGACAAGAAGAACACCAACAAGTGCTCCCTGGGCTGAGGACCCTTTCTTGC CTCCCCACCCCGGAAGCTGAACCTGAGGGAGACAACGGCAGAGGGAGTGAGCAGGGGAGA AATAGCAGAGGGGCTTGGAGGGTCACATAGGTAGATGGTAAAGAGAATGAGGAGAAAAAG GAGAAAAGGGAAAAGCAGAAAGGAAAAAAAGGAAGAGAGAGGAAGGGAGAAGGGAGAGGA ATGAATTGAGGAAGTGAAAGAAGGCAAGGAGGTAGGAAGAGAGGGAGGAGGAAAGGAAGG AGAGATGCCTCAGGCTTCAGACCTTACCTGGGTTTTCAGGGCAAACATAAATGTAAATAC ACTGATTTATTCTGTTACTAGATCAGGTTTTAGGGTCCTGCAAAAGGCTAGCTCGGCACT ACACTAGGGAATTTGCTCCTGTTCTGTCACTTGTCATGGTCTTTCTTGGTATTAAAGGCC ACCATTTGCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002870 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002870.2, NP_002861.1 |
RefSeq Size | 1211 bp |
RefSeq ORF | 612 bp |
Locus ID | 5872 |
UniProt ID | P51153 |
Cytogenetics | 1q21.3 |
Domains | ras, RAN, RAS, RHO, RAB, ARF |
Protein Families | Druggable Genome |
Protein Pathways | Tight junction |
Gene Summary | This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201555 | RAB13 (Myc-DDK-tagged)-Human RAB13, member RAS oncogene family (RAB13) |
USD 300.00 |
|
RC201555L1 | Lenti ORF clone of Human RAB13, member RAS oncogene family (RAB13), Myc-DDK-tagged |
USD 600.00 |
|
RC201555L2 | Lenti ORF clone of Human RAB13, member RAS oncogene family (RAB13), mGFP tagged |
USD 600.00 |
|
RC201555L3 | Lenti ORF clone of Human RAB13, member RAS oncogene family (RAB13), Myc-DDK-tagged |
USD 600.00 |
|
RC201555L4 | Lenti ORF clone of Human RAB13, member RAS oncogene family (RAB13), mGFP tagged |
USD 600.00 |
|
RG201555 | RAB13 (tGFP-tagged) - Human RAB13, member RAS oncogene family (RAB13) |
USD 500.00 |
|
SC118356 | RAB13 (untagged)-Human RAB13, member RAS oncogene family (RAB13) |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review