EXOSC1 (NM_016046) Human Untagged Clone
CAT#: SC322121
EXOSC1 (untagged)-Human exosome component 1 (EXOSC1)
"NM_016046" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EXOSC1 |
Synonyms | CGI-108; CSL4; Csl4p; p13; PCH1F; SKI4; Ski4p |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322121
GGCAATCATGGCGCCACCTGTGAGATACTGCATCCCCGGCGAACGTCTGTGTAACTTGGA
GGAGGGCAGCCCGGGCAGCGGCACCTACACCCGCCACGGCTACATCTTTTCGTCGCTTGC CGGCTGTCTGATGAAGAGCAGCGAGAATGGCGCGCTTCCAGTGGTGTCTGTAGTGAGAGA AACAGAGTCCCAGTTACTGCCAGATGTGGGAGCTATTGTAACCTGTAAGGTCTCTAGCAT CAATTCACGCTTTGCCAAAGTACACATCCTGTATGTGGGGTCCATGCCTCTTAAGAACTC TTTTCGAGGAACTATCCGCAAGGAAGATGTCCGAGCAACTGAAAAAGACAAGGTTGAAAT TTATAAGAGTTTCCGCCCAGGTGACATTGTCTTGGCCAAAGTGATCTCCTTAGGTGATGC ACAGTCCAACTACCTGCTAACCACCGCCGAGAACGAGCTGGGAGTGGTGGTAGCCCACAG TGAGTCAGGTATCCAGATGGTTCCCATCAGCTGGTGTGAGATGCAGTGCCCTAAGACCCA CACTAAAGAATTCCGGAAAGTAGCCCGAGTACAACCCGAATTCTTGCAGACCTAAGAAGC CACTTTTTACCCTATGGAAGGGGGTAAGCTGTTCCTGAGTATAACACCAAGATGCTGCTG TCTTTATTCAAACACCTGGCGTCGGCCAACAGCCACTTCCAGAAAAATCTTCCAGTTTAC GCTGTAGATGGAACATGTTTCTGTGAACCTATCAGTGGATTTCATTCTCTTGAGTAATAA ATCTTATCTTTTCAAGACAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_016046 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016046.3, NP_057130.1 |
RefSeq Size | 1150 bp |
RefSeq ORF | 588 bp |
Locus ID | 51013 |
UniProt ID | Q9Y3B2 |
Cytogenetics | 10q24.1 |
Protein Pathways | RNA degradation |
Gene Summary | This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206007 | EXOSC1 (Myc-DDK-tagged)-Human exosome component 1 (EXOSC1) |
USD 300.00 |
|
RC206007L1 | Lenti ORF clone of Human exosome component 1 (EXOSC1), Myc-DDK-tagged |
USD 600.00 |
|
RC206007L2 | Lenti ORF clone of Human exosome component 1 (EXOSC1), mGFP tagged |
USD 600.00 |
|
RC206007L3 | Lenti ORF clone of Human exosome component 1 (EXOSC1), Myc-DDK-tagged |
USD 600.00 |
|
RC206007L4 | Lenti ORF clone of Human exosome component 1 (EXOSC1), mGFP tagged |
USD 600.00 |
|
RG206007 | EXOSC1 (tGFP-tagged) - Human exosome component 1 (EXOSC1) |
USD 500.00 |
|
SC114517 | EXOSC1 (untagged)-Human exosome component 1 (EXOSC1) |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review