RHBDD1 (NM_032276) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | RHBDD1 |
Synonyms | RHBDL4; RRP4 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_032276, the custom clone sequence may differ by one or more nucleotides
ATGCAACGGAGATCAAGAGGGATAAATACTGGACTTATTCTACTCCTTTCTCAAATCTTCCATGTTGGGA TCAACAATATTCCACCTGTCACCCTAGCAACTTTGGCCCTCAACATCTGGTTCTTCTTGAACCCTCAGAA GCCACTGTATAGCTCCTGCCTTAGTGTGGAGAAGTGTTACCAGCAAAAAGACTGGCAGCGTTTACTGCTC TCTCCCCTTCACCATGCTGATGATTGGCATTTGTATTTCAATATGGCATCCATGCTCTGGAAAGGAATAA ATCTAGAAAGAAGACTGGGAAGTAGATGGTTTGCCTATGTTATCACCGCATTTTCTGTACTTACTGGAGT GGTATACCTGCTCTTGCAATTTGCTGTTGCCGAATTTATGGATGAACCTGACTTCAAAAGGAGCTGTGCT GTAGGTTTCTCAGGAGTTTTGTTTGCTTTGAAAGTTCTTAACAACCATTATTGCCCTGGAGGCTTTGTCA ACATTTTGGGCTTTCCTGTACCGAACAGATTTGCTTGTTGGGTCGAACTTGTGGCTATTCATTTATTCTC ACCAGGGACTTCCTTCGCTGGGCATCTGGCTGGGATTCTTGTTGGACTAATGTACACTCAAGGGCCTCTG AAGAAAATCATGGAAGCATGTGCAGGCGGTTTTTCCTCCAGTGTTGGTTACCCAGGACGGCAATACTACT TTAATAGTTCAGGCAGCTCTGGATATCAGGATTATTATCCGCATGGCAGGCCAGATCACTATGAAGAAGC ACCCAGGAACTATGACACGTACACAGCAGGACTGAGTGAAGAAGAACAGCTCGAGAGAGCATTACAAGCC AGCCTCTGGGACCGAGGAAATACCAGAAATAGCCCACCACCCTACGGGTTTCATCTCTCACCAGAAGAAA TGAGGAGACAGCGGCTTCACAGATTCGATAGCCAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_032276 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_032276.2, NP_115652.2 |
RefSeq Size | 2438 bp |
RefSeq ORF | 948 bp |
Locus ID | 84236 |
UniProt ID | Q8TEB9 |
Cytogenetics | 2q36.3 |
Protein Families | Transmembrane |
Summary | Intramembrane-cleaving serine protease that cleaves single transmembrane or multi-pass membrane proteins in the hydrophobic plane of the membrane, luminal loops and juxtamembrane regions. Involved in regulated intramembrane proteolysis and the subsequent release of functional polypeptides from their membrane anchors. Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded membrane proteins. Required for the degradation process of some specific misfolded endoplasmic reticulum (ER) luminal proteins. Participates in the transfer of misfolded proteins from the ER to the cytosol, where they are destroyed by the proteasome in a ubiquitin-dependent manner. Functions in BIK, MPZ, PKD1, PTCRA, RHO, STEAP3 and TRAC processing. Involved in the regulation of exosomal secretion; inhibits the TSAP6-mediated secretion pathway. Involved in the regulation of apoptosis; modulates BIK-mediated apoptotic activity. Also plays a role in the regulation of spermatogenesis; inhibits apoptotic activity in spermatogonia.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) and variants 2-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210708 | RHBDD1 (Myc-DDK-tagged)-Human rhomboid domain containing 1 (RHBDD1), transcript variant 1 | 10 ug |
$300.00
|
|
RC210708L1 | Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC210708L2 | Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC210708L3 | Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC210708L4 | Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG210708 | RHBDD1 (tGFP-tagged) - Human rhomboid domain containing 1 (RHBDD1), transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
SC111465 | RHBDD1 (untagged)-Human rhomboid domain containing 1 (RHBDD1), transcript variant 1 | 10 ug |
$150.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.