RHBDD1 (NM_032276) Human Untagged Clone

SKU
SC322075
RHBDD1 (untagged)-Human rhomboid domain containing 1 (RHBDD1), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RHBDD1
Synonyms RHBDL4; RRP4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032276, the custom clone sequence may differ by one or more nucleotides


ATGCAACGGAGATCAAGAGGGATAAATACTGGACTTATTCTACTCCTTTCTCAAATCTTCCATGTTGGGA
TCAACAATATTCCACCTGTCACCCTAGCAACTTTGGCCCTCAACATCTGGTTCTTCTTGAACCCTCAGAA
GCCACTGTATAGCTCCTGCCTTAGTGTGGAGAAGTGTTACCAGCAAAAAGACTGGCAGCGTTTACTGCTC
TCTCCCCTTCACCATGCTGATGATTGGCATTTGTATTTCAATATGGCATCCATGCTCTGGAAAGGAATAA
ATCTAGAAAGAAGACTGGGAAGTAGATGGTTTGCCTATGTTATCACCGCATTTTCTGTACTTACTGGAGT
GGTATACCTGCTCTTGCAATTTGCTGTTGCCGAATTTATGGATGAACCTGACTTCAAAAGGAGCTGTGCT
GTAGGTTTCTCAGGAGTTTTGTTTGCTTTGAAAGTTCTTAACAACCATTATTGCCCTGGAGGCTTTGTCA
ACATTTTGGGCTTTCCTGTACCGAACAGATTTGCTTGTTGGGTCGAACTTGTGGCTATTCATTTATTCTC
ACCAGGGACTTCCTTCGCTGGGCATCTGGCTGGGATTCTTGTTGGACTAATGTACACTCAAGGGCCTCTG
AAGAAAATCATGGAAGCATGTGCAGGCGGTTTTTCCTCCAGTGTTGGTTACCCAGGACGGCAATACTACT
TTAATAGTTCAGGCAGCTCTGGATATCAGGATTATTATCCGCATGGCAGGCCAGATCACTATGAAGAAGC
ACCCAGGAACTATGACACGTACACAGCAGGACTGAGTGAAGAAGAACAGCTCGAGAGAGCATTACAAGCC
AGCCTCTGGGACCGAGGAAATACCAGAAATAGCCCACCACCCTACGGGTTTCATCTCTCACCAGAAGAAA
TGAGGAGACAGCGGCTTCACAGATTCGATAGCCAGTGA


Restriction Sites Please inquire
ACCN NM_032276
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032276.2, NP_115652.2
RefSeq Size 2438 bp
RefSeq ORF 948 bp
Locus ID 84236
UniProt ID Q8TEB9
Cytogenetics 2q36.3
Protein Families Transmembrane
Summary Intramembrane-cleaving serine protease that cleaves single transmembrane or multi-pass membrane proteins in the hydrophobic plane of the membrane, luminal loops and juxtamembrane regions. Involved in regulated intramembrane proteolysis and the subsequent release of functional polypeptides from their membrane anchors. Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded membrane proteins. Required for the degradation process of some specific misfolded endoplasmic reticulum (ER) luminal proteins. Participates in the transfer of misfolded proteins from the ER to the cytosol, where they are destroyed by the proteasome in a ubiquitin-dependent manner. Functions in BIK, MPZ, PKD1, PTCRA, RHO, STEAP3 and TRAC processing. Involved in the regulation of exosomal secretion; inhibits the TSAP6-mediated secretion pathway. Involved in the regulation of apoptosis; modulates BIK-mediated apoptotic activity. Also plays a role in the regulation of spermatogenesis; inhibits apoptotic activity in spermatogonia.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) and variants 2-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RHBDD1 (NM_032276) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210708 RHBDD1 (Myc-DDK-tagged)-Human rhomboid domain containing 1 (RHBDD1), transcript variant 1 10 ug
$300.00
RC210708L1 Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210708L2 Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, mGFP tagged 10 ug
$600.00
RC210708L3 Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210708L4 Lenti ORF clone of Human rhomboid domain containing 1 (RHBDD1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG210708 RHBDD1 (tGFP-tagged) - Human rhomboid domain containing 1 (RHBDD1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC111465 RHBDD1 (untagged)-Human rhomboid domain containing 1 (RHBDD1), transcript variant 1 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.