SUMF1 (NM_182760) Human Untagged Clone

SKU
SC322060
SUMF1 (untagged)-Human sulfatase modifying factor 1 (SUMF1), transcript variant 1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SUMF1
Synonyms AAPA3037; FGE; UNQ3037
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_182760, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGAGCTGGGTCTCGTCCTCTTGCTGCTGC
TGCTCTCGCTGCTGTGTGGAGCGGCAGGGAGCCAGGAGGCCGGGACCGGTGCGGGCGCGGGGTCCCTTGC
GGGTTCTTGCGGCTGCGGCACGCCCCAGCGGCCTGGCGCCCATGGCAGTTCGGCAGCCGCTCACCGATAC
TCGCGGGAGGCTAACGCTCCGGGCCCCGTACCCGGAGAGCGGCAACTCGCGCACTCAAAGATGGTCCCCA
TCCCTGCTGGAGTATTTACAATGGGCACAGATGATCCTCAGATAAAGCAGGATGGGGAAGCACCTGCGAG
GAGAGTTACTATTGATGCCTTTTACATGGATGCCTATGAAGTCAGTAATACTGAATTTGAGAAGTTTGTG
AACTCAACTGGCTATTTGACAGAGGCTGAGAAGTTTGGCGACTCCTTTGTCTTTGAAGGCATGTTGAGTG
AGCAAGTGAAGACCAATATTCAACAGGCAGTTGCAGCTGCTCCCTGGTGGTTACCTGTGAAAGGCGCTAA
CTGGAGACACCCAGAAGGGCCTGACTCTACTATTCTGCACAGGCCGGATCATCCAGTTCTCCATGTGTCC
TGGAATGATGCGGTTGCCTACTGCACTTGGGCAGGGAAGCGGCTGCCCACGGAAGCTGAGTGGGAATACA
GCTGTCGAGGAGGCCTGCATAATAGACTTTTCCCCTGGGGCAACAAACTGCAGCCCAAAGGCCAGCATTA
TGCCAACATTTGGCAGGGCGAGTTTCCGGTGACCAACACTGGTGAGGATGGCTTCCAAGGAACTGCGCCT
GTTGATGCCTTCCCTCCCAATGGTTATGGCTTATACAACATAGTGGGGAACGCATGGGAATGGACTTCAG
ACTGGTGGACTGTTCATCATTCTGTTGAAGAAACGCTTAACCCAAAAGGTCCCCCTTCTGGGAAAGACCG
AGTGAAGAAAGGTGGATCCTACATGTGCCATAGGTCTTATTGTTACAGGTATCGCTGTGCTGCTCGGAGC
CAGAACACACCTGATAGCTCTGCTTCGAATCTGGGATTCCGCTGTGCAGCCGACCGCCTGCCCACTATGG
ACTGA


Restriction Sites Please inquire
ACCN NM_182760
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_182760.2, NP_877437.2
RefSeq Size 2148 bp
RefSeq ORF 1125 bp
Locus ID 285362
UniProt ID Q8NBK3
Cytogenetics 3p26.1
Summary This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:SUMF1 (NM_182760) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211092 SUMF1 (Myc-DDK-tagged)-Human sulfatase modifying factor 1 (SUMF1), transcript variant 1 10 ug
$686.00
RC211092L1 Lenti ORF clone of Human sulfatase modifying factor 1 (SUMF1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC211092L2 Lenti ORF clone of Human sulfatase modifying factor 1 (SUMF1), transcript variant 1, mGFP tagged 10 ug
$986.00
RC211092L3 Lenti ORF clone of Human sulfatase modifying factor 1 (SUMF1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC211092L4 Lenti ORF clone of Human sulfatase modifying factor 1 (SUMF1), transcript variant 1, mGFP tagged 10 ug
$986.00
RG211092 SUMF1 (tGFP-tagged) - Human sulfatase modifying factor 1 (SUMF1), transcript variant 1 10 ug
$886.00
SC107512 SUMF1 (untagged)-Human sulfatase modifying factor 1 (SUMF1), transcript variant 1 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.