MTCH1 (NM_014341) Human Untagged Clone

SKU
SC322048
MTCH1 (untagged)-Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MTCH1
Synonyms CGI-64; PIG60; PSAP; SLC25A49
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_014341, the custom clone sequence may differ by one or more nucleotides


ATGGGAGCTTCGGACCCGGAAGTGGCGCCCTGGGCTCGCGGCGGTGCCGCGGGGATGGCGGGAGCCGGAG
CTGGAGCCGGAGCTCGCGGCGGAGCGGCGGCGGGGGTCGAGGCTCGAGCTCGCGATCCACCGCCCGCGCA
CCGCGCACATCCTCGCCACCCTCGGCCTGCGGCTCAGCCCTCGGCCCGCAGGATGGATGGCGGGTCAGGG
GGCCTGGGGTCTGGGGACAACGCCCCGACCACTGAGGCTCTTTTCGTGGCACTGGGCGCGGGCGTGACGG
CGCTCAGCCATCCCCTGCTCTACGTGAAGCTGCTCATCCAGGTGGGTCATGAGCCGATGCCCCCCACCCT
TGGGACCAATGTGCTGGGGAGGAAGGTCCTCTATCTGCCGAGCTTCTTCACCTACGCCAAGTACATCGTG
CAAGTGGATGGTAAGATAGGGCTGTTCCGAGGCCTGAGTCCCCGGCTGATGTCCAACGCCCTCTCTACTG
TGACTCGGGGTAGCATGAAGAAGGTTTTCCCTCCAGATGAGATTGAGCAGGTTTCCAACAAGGATGATAT
GAAGACTTCCCTGAAGAAAGTTGTGAAGGAGACCTCCTACGAGATGATGATGCAGTGTGTGTCCCGCATG
TTGGCCCACCCCCTGCATGTCATCTCAATGCGCTGCATGGTCCAGTTTGTGGGACGGGAGGCCAAGTACA
GTGGTGTGCTGAGCTCCATTGGGAAGATTTTCAAAGAGGAAGGGCTGCTGGGATTCTTCGTTGGATTAAT
CCCTCACCTCCTGGGCGATGTGGTTTTCTTGTGGGGCTGTAACCTGCTGGCCCACTTCATCAATGCCTAC
CTGGTGGATGACAGCTTCAGCCAGGCCCTGGCCATCCGGAGCTATACCAAGTTCGTGATGGGGATTGCAG
TGAGCATGCTGACCTACCCCTTCCTGCTAGTTGGCGACCTCATGGCTGTGAACAACTGCGGGCTGCAAGC
TGGGCTCCCCCCTTACTCCCCAGTGTTCAAATCCTGGATTCACTGCTGGAAGTACCTGAGTGTGCAGGGC
CAGCTCTTCCGAGGCTCCAGCCTGCTTTTCCGCCGGGTGTCATCAGGATCATGCTTTGCCCTGGAGTAA


Restriction Sites Please inquire
ACCN NM_014341
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014341.1, NP_055156.1
RefSeq Size 1890 bp
RefSeq ORF 1119 bp
Locus ID 23787
UniProt ID Q9NZJ7
Cytogenetics 6p21.2
Domains mito_carr
Protein Families Transmembrane
Summary This gene encodes a member of the mitochondrial carrier family. The encoded protein is localized to the mitochondrion inner membrane and induces apoptosis independent of the proapoptotic proteins Bax and Bak. Pseudogenes on chromosomes 6 and 11 have been identified for this gene. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (1) encodes the shorter isoform (PSAP-LS, PMID 18291114). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:MTCH1 (NM_014341) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211131 MTCH1 (Myc-DDK-tagged)-Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein 10 ug
$457.00
RC211131L3 Lenti ORF clone of Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$757.00
RC211131L4 Lenti ORF clone of Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$757.00
RG211131 MTCH1 (tGFP-tagged) - Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC115051 MTCH1 (untagged)-Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.