MPV17L (NM_173803) Human Untagged Clone

SKU
SC322006
MPV17L (untagged)-Human MPV17 mitochondrial membrane protein-like (MPV17L), nuclear gene encoding mitochondrial protein, transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MPV17L
Synonyms M-LPH; MLPH1; MLPH2; MPV17L1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322006 TGCAGTAGCTGCTGGAGGCTGGGGAGGCCCGGACCCGGTGCAGGAAGACGCCGACCACGC
GGGCTCCTGATCGCGGGCGCCCACAGCGCGGACATGGCGGGCTGGTGGCCGGCGTTGTCG
CGCGCGGCCCGGCGCCACCCGTGGCCCACCAACGTGCTGCTTTACGGCTCGCTCGTCTCG
GCCGGGGACGCGCTGCAACAGCGGCTGCAGGGCCGCGAGGCCAACTGGCGCCAGACGCGG
CGCGTGGCCACGTTGGTGGTGACCTTCCACGCCAACTTCAACTACGTGTGGCTGCGCCTG
CTGGAGCGCGCGCTCCCGGGCCGAGCGCCGCACGCCCTGCTGGCCAAGTTGCTGTGCGAC
CAGGTGGTCGGTGCGCCCATCGCGGTCTCGGCCTTCTATGTCGAGTGGACTGATGTACTG
GCCCTTTGTACAGCTGACCAACTTCAGCCTTGTTCCTGTTCAATGGAGAACAGCTTACGC
TGGAGTCTGTGGTTTTCTCTGGGCCACCTTCATCTGTTTTTCCCAGCAGAGTGGTGACGG
CACATTCAAGTCAGCTTTCACCATTTTATATACAAAGGGGACCAGTGCCACAGAAGGGTA
CCCGAAGAAATGAGAAGTCAAGGACTCTCTTAAAGGGACCACATTTTTTACCTAAAATGC
ACAGAATTGCCTGCAGACAAAATATTTGATGTGCCAATTATGCACTTCATTTTGAGGAAT
TACTACTATTTATAGACCCACTTTTTAAAAAATTATCAATGATTATTTTTGAATTGTATT
CAGACTTTTTTCCTGTTCTAGTCTGAAATATACTTCTCTAATATTTTGGTTAATATGAAT
AATAGTGGCAAAATGGCATTTTAGAATTATTAATATTTCTAATATTTTAACACAAAAAAA
AAAAAAAA
Restriction Sites Please inquire
ACCN NM_173803
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173803.2, NP_776164.1
RefSeq Size 2211 bp
RefSeq ORF 444 bp
Locus ID 255027
UniProt ID Q2QL34
Cytogenetics 16p13.11
Summary Isoform 1 participates in reactive oxygen species metabolism by up- or down-regulation of the genes of antioxidant enzymes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate segment, which shifts the reading frame, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:MPV17L (NM_173803) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208970 MPV17L (Myc-DDK-tagged)-Human MPV17 mitochondrial membrane protein-like (MPV17L), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$150.00
RC208970L3 Lenti ORF clone of Human MPV17 mitochondrial membrane protein-like (MPV17L), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC208970L4 Lenti ORF clone of Human MPV17 mitochondrial membrane protein-like (MPV17L), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged 10 ug
$450.00
RG208970 MPV17L (tGFP-tagged) - Human MPV17 mitochondrial membrane protein-like (MPV17L), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.