Factor X (F10) (NM_000504) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Factor X |
Synonyms | FX; FXA |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_000504.3
GTCCCAGTGAGGACAGGGACACAGTACTCGGCCACACCATGGGGCGCCCACTGCACCTCG
TCCTGCTCAGTGCCTCCCTGGCTGGCCTCCTGCTGCTCGGGGAAAGTCTGTTCATCCGCA GGGAGCAGGCCAACAACATCCTGGCGAGGGTCACGAGGGCCAATTCCTTTCTTGAAGAGA TGAAGAAAGGACACCTCGAAAGAGAGTGCATGGAAGAGACCTGCTCATACGAAGAGGCCC GCGAGGTCTTTGAGGACAGCGACAAGACGAATGAATTCTGGAATAAATACAAAGATGGCG ACCAGTGTGAGACCAGTCCTTGCCAGAACCAGGGCAAATGTAAAGACGGCCTCGGGGAAT ACACCTGCACCTGTTTAGAAGGATTCGAAGGCAAAAACTGTGAATTATTCACACGGAAGC TCTGCAGCCTGGACAACGGGGACTGTGACCAGTTCTGCCACGAGGAACAGAACTCTGTGG TGTGCTCCTGCGCCCGCGGGTACACCCTGGCTGACAACGGCAAGGCCTGCATTCCCACAG GGCCCTACCCCTGTGGGAAACAGACCCTGGAACGCAGGAAGAGGTCAGTGGCCCAGGCCA CCAGCAGCAGCGGGGAGGCCCCTGACAGCATCACATGGAAGCCATATGATGCAGCCGACC TGGACCCCACCGAGAACCCCTTCGACCTGCTTGACTTCAACCAGACGCAGCCTGAGAGGG GCGACAACAACCTCACCAGGATCGTGGGAGGCCAGGAATGCAAGGACGGGGAGTGTCCCT GGCAGGCCCTGCTCATCAATGAGGAAAACGAGGGTTTCTGTGGTGGAACTATTCTGAGCG AGTTCTACATCCTAACGGCAGCCCACTGTCTCTACCAAGCCAAGAGATTCAAGGTGAGGG TAGGGGACCGGAACACGGAGCAGGAGGAGGGCGGTGAGGCGGTGCACGAGGTGGAGGTGG TCATCAAGCACAACCGGTTCACAAAGGAGACCTATGACTTCGACATCGCCGTGCTCCGGC TCAAGACCCCCATCACCTTCCGCATGAACGTGGCGCCTGCCTGCCTCCCCGAGCGTGACT GGGCCGAGTCCACGCTGATGACGCAGAAGACGGGGATTGTGAGCGGCTTCGGGCGCACCC ACGAGAAGGGCCGGCAGTCCACCAGGCTCAAGATGCTGGAGGTGCCCTACGTGGACCGCA ACAGCTGCAAGCTGTCCAGCAGCTTCATCATCACCCAGAACATGTTCTGTGCCGGCTACG ACACCAAGCAGGAGGATGCCTGCCAGGGGGACAGCGGGGGCCCGCACGTCACCCGCTTCA AGGACACCTACTTCGTGACAGGCATCGTCAGCTGGGGAGAGGGCTGTGCCCGTAAGGGGA AGTACGGGATCTACACCAAGGTCACCGCCTTCCTCAAGTGGATCGACAGGTCCATGAAAA CCAGGGGCTTGCCCAAGGCCAAGAGCCATGCCCCGGAGGTCATAACGTCCTCTCCATTAA AGTGAGATCCCACTCAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000504 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000504.3, NP_000495.1 |
RefSeq Size | 1560 bp |
RefSeq ORF | 1467 bp |
Locus ID | 2159 |
UniProt ID | P00742 |
Cytogenetics | 13q34 |
Domains | EGF, EGF_CA, GLA, Tryp_SPc |
Protein Families | Druggable Genome, Protease, Transmembrane |
Protein Pathways | Complement and coagulation cascades |
Summary | This gene encodes the vitamin K-dependent coagulation factor X of the blood coagulation cascade. This factor undergoes multiple processing steps before its preproprotein is converted to a mature two-chain form by the excision of the tripeptide RKR. Two chains of the factor are held together by 1 or more disulfide bonds; the light chain contains 2 EGF-like domains, while the heavy chain contains the catalytic domain which is structurally homologous to those of the other hemostatic serine proteases. The mature factor is activated by the cleavage of the activation peptide by factor IXa (in the intrisic pathway), or by factor VIIa (in the extrinsic pathway). The activated factor then converts prothrombin to thrombin in the presence of factor Va, Ca+2, and phospholipid during blood clotting. Mutations of this gene result in factor X deficiency, a hemorrhagic condition of variable severity. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature polypeptides. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC208506 | F10 (Myc-DDK-tagged)-Human coagulation factor X (F10) | 10 ug |
$457.00
|
|
RC208506L1 | Lenti ORF clone of Human coagulation factor X (F10), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC208506L2 | Lenti ORF clone of Human coagulation factor X (F10), mGFP tagged | 10 ug |
$757.00
|
|
RC208506L3 | Lenti ORF clone of Human coagulation factor X (F10), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC208506L4 | Lenti ORF clone of Human coagulation factor X (F10), mGFP tagged | 10 ug |
$757.00
|
|
RG208506 | F10 (tGFP-tagged) - Human coagulation factor X (F10) | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.