RPAIN (NM_001033002) Human Untagged Clone

SKU
SC321870
RPAIN (untagged)-Human RPA interacting protein (RPAIN), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RPAIN
Synonyms HRIP; RIP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001033002.1 GAGATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCCCTGTACAAACTGGTGGGCTCGCCG
CCTTGGAAAGAGGCTTTCCGGCAGAGATGCCTGGAGAGAATGAGAAACAGCCGGGACAGG
CTCCTAAACAGGTACCGCCAGGCTGGAAGCAGTGGGCCAGGGAATTCTCAGAACAGCTTT
CTAGTTCAAGAGGTGATGGAAGAAGAGTGGAATGCTTTGCAGTCAGTGGAGAATTGTCCA
GAAGACTTGGCTCAGTTGGAGGAGCTGATAGACATGGCTGTGCTGGAGGAAATTCAACAG
GAGCTGATCAAGCAAGAGCAGTCCATCATCAGCGAGTATGAGAAGAGCTTGCAGTTTGAT
GAAAAGTGTCTCAGCATCATGCTGGCTGAGTGGGAGGCAAACCCACTCATCTGTCCTGTA
TGTACAAAGTACAACCTGAGAATCACAAGCGGTGTGGTGGTGTGTCAGTGTGGCCTGTCC
ATCCCATCTCATTCTTCTGAGTTGACAGAGCAGAAGCTTCGTGCCTGTTTAGAGGGTAGT
ATAAATGAGCACAGTGCACATTGTCCCCACACACCTGAATTTTCAGTCACTGGAGGAACA
GAAGAAAAGTCCAGTCTTCTCATGAGCTGTCTGGCCTGTGATACTTGGGCTGTGATCCTC
TAGAGCCAGCTTGGACTCACATCATTCTATGGGGTTGAAGACAACTCATTCCCTCTGAGG
AGCCTTGTACATACAAGCCTTTTATTTATAACTTATTTTGTATTGAAACTTTTAAACAAT
ACTGAAGAAAAAAAAACTTTTCCGAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_001033002
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033002.1, NP_001028174.1
RefSeq Size 1536 bp
RefSeq ORF 660 bp
Locus ID 84268
UniProt ID Q86UA6
Cytogenetics 17p13.2
Summary Mediates the import of RPA complex into the nucleus, possibly via some interaction with importin beta. Isoform 2 is sumoylated and mediates the localization of RPA complex into the PML body of the nucleus, thereby participating in RPA function in DNA metabolism.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. It encodes isoform b, which has a shorter and distinct C-terminus compared to isoform a.
Write Your Own Review
You're reviewing:RPAIN (NM_001033002) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208684 RPAIN (Myc-DDK-tagged)-Human RPA interacting protein (RPAIN), transcript variant 2 10 ug
$300.00
RC208684L3 Lenti ORF clone of Human RPA interacting protein (RPAIN), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC208684L4 Lenti ORF clone of Human RPA interacting protein (RPAIN), transcript variant 2, mGFP tagged 10 ug
$600.00
RG208684 RPAIN (tGFP-tagged) - Human RPA interacting protein (RPAIN), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.