CDC42EP5 (NM_145057) Human Untagged Clone

SKU SC321765

CDC42EP5 (untagged)-Human CDC42 effector protein (Rho GTPase binding) 5 (CDC42EP5)

Product Data

• Type: Human Untagged Clone
• Target Symbol: CDC42EP5
• Synonyms: Borg3; CEP5
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_145057.2 CGCCCAGAGGGGCCTCAGCTTTTCCACCACTGCTTTCTAGTCCTTTAACTCCTAGAGGCA; AACTTTTGGGGGATAAGAAAGCCTGGGAGGGGCCTGTGCCAAAACCCTCTCTGCCTGGGG; ACTGGGCGGTGATTCCGCTTCTGCCTGGGCTCCTGCCATGGCCCCCGAGAGGGGCTGACA; CTTTAGCTCCCGGTGCAGGTGAGAACCCGCCCGGAGGAAGAAGGAAGGCGCGGGCCGGGG; ATTAGGAGACGGAGGCGGACTCGGAGCCAGGGAACCAGGGGTCCGGGCTAGAGCTGGAGT; CGTGAGCGCGCGCCCGCCCCGCTCTGGGAGGACCGCGAGATGCCCGTGCTGAAGCAGCTG; GGCCCCGCGCAGCCCAAGAAGCGGCCTGATCGCGGCGCCCTGTCCATCTCCGCGCCGCTC; GGCGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACGCCTTCGGGGACACCTCG; TTCCTGAGCCGCCACGGCGGCGGGCCGCCCCCCCAGCCCCGGGCGCCCCCCGCGGGGGCC; CCGCGCTCCCCGCCGCCGCCCGCCGTCCCGCAGTCCGCAGCGCCCTCGCCTGCCGACCCG; CTGCTGTCCTTCCACCTGGATCTGGGGCCCTCCATGCTGGACGCGGTGCTGGGCGTCATG; GACGCGGCGCGCCCGGAGGCGGCTGCCGCCAAGCCCGACGCGGAACCCCGCCCCGGGACG; CAGCCCCCCCAGGCCCGCTGCCGCCCCAACGCGGACCTCGAGCTGAACGACGTCATCGGC; CTCTAGGTTCCCTCATTCCCCGCGCCCTTCCCGCCCGGCACCCCACTTCTGTATACATAA; ACGGCCAAGGTGTGTGCCCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA; AAAGAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_145057
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_145057.2, NP_659494.2
• RefSeq Size: 917 bp
• RefSeq ORF: 447 bp
• Locus ID: 148170
• UniProt ID: Q6NZY7
• Cytogenetics: 19q13.42
• Domains: PBD
• Summary: Cell division control protein 42 (CDC42), a small Rho GTPase, regulates the formation of F-actin-containing structures through its interaction with the downstream effector proteins. The protein encoded by this gene is a member of the Borg (binder of Rho GTPases) family of CDC42 effector proteins. Borg family proteins contain a CRIB (Cdc42/Rac interactive-binding) domain. They bind to CDC42 and regulate its function negatively. The encoded protein may inhibit c-Jun N-terminal kinase (JNK) independently of CDC42 binding. The protein may also play a role in septin organization and inducing pseudopodia formation in fibroblasts [provided by RefSeq, Jul 2013]