Granzyme B (GZMB) (NM_004131) Human Untagged Clone
SKU
SC321693
GZMB (untagged)-Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Granzyme B |
Synonyms | C11; CCPI; CGL-1; CGL1; CSP-B; CSPB; CTLA1; CTSGL1; HLP; SECT |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_004131.3
CCAGGGCAGCCTTCCTGAGAAGATGCAACCAATCCTGCTTCTGCTGGCCTTCCTCCTGCT
GCCCAGGGCAGATGCAGGGGAGATCATCGGGGGACATGAGGCCAAGCCCCACTCCCGCCC CTACATGGCTTATCTTATGATCTGGGATCAGAAGTCTCTGAAGAGGTGCGGTGGCTTCCT GATACAAGACGACTTCGTGCTGACAGCTGCTCACTGTTGGGGAAGCTCCATAAATGTCAC CTTGGGGGCCCACAATATCAAAGAACAGGAGCCGACCCAGCAGTTTATCCCTGTGAAAAG ACCCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCA GCTGGAGAGAAAGGCCAAGCGGACCAGAGCTGTGCAGCCCCTCAGGCTACCTAGCAACAA GGCCCAGGTGAAGCCAGGGCAGACATGCAGTGTGGCCGGCTGGGGGCAGACGGCCCCCCT GGGAAAACACTCACACACACTACAAGAGGTGAAGATGACAGTGCAGGAAGATCGAAAGTG CGAATCTGACTTACGCCATTATTACGACAGTACCATTGAGTTGTGCGTGGGGGACCCAGA GATTAAAAAGACTTCCTTTAAGGGGGACTCTGGAGGCCCTCTTGTGTGTAACAAGGTGGC CCAGGGCATTGTCTCCTATGGACGAAACAATGGCATGCCTCCACGAGCCTGCACCAAAGT CTCAAGCTTTGTACACTGGATAAAGAAAACCATGAAACGCCACTAACTACAGGAAGCAAA CTAAGCCCCCGCTGTGATGAAACACCTTCTCTGGAGCCAAGTCCAGATTTACACTGGGAG AGGTGCCAGCAACTGAATAAATACCTCTTAGCTGAGTGGAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004131 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004131.3, NP_004122.1 |
RefSeq Size | 955 bp |
RefSeq ORF | 744 bp |
Locus ID | 3002 |
UniProt ID | P10144 |
Cytogenetics | 14q12 |
Domains | Tryp_SPc |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Allograft rejection, Autoimmune thyroid disease, Graft-versus-host disease, Natural killer cell mediated cytotoxicity, Type I diabetes mellitus |
Summary | This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Expression of this gene may be elevated in human patients with cardiac fibrosis. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC206495 | GZMB (Myc-DDK-tagged)-Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB) | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
RC206495L1 | Lenti ORF clone of Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC206495L2 | Lenti ORF clone of Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB), mGFP tagged | 10 ug |
$600.00
|
|
RC206495L3 | Lenti ORF clone of Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC206495L4 | Lenti ORF clone of Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB), mGFP tagged | 10 ug |
$600.00
|
|
RG206495 | GZMB (tGFP-tagged) - Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.