AKR1C3 (NM_003739) Human Untagged Clone

SKU
SC321532
AKR1C3 (untagged)-Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AKR1C3
Synonyms DD3; DDX; HA1753; HAKRB; HAKRe; hluPGFS; HSD17B5; PGFS
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003739.4 GTAATCTCTGAGGAGAAGCAGCAGCAAACATTTGCTAGTCAGACAAGTGACAGGGAATGG
ATTCCAAACACCAGTGTGTAAAGCTAAATGATGGCCACTTCATGCCTGTATTGGGATTTG
GCACCTATGCACCTCCAGAGGTTCCAAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAA
TAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTG
GACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACA
CTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACT
CACTGAAAAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTC
TAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAG
TGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGT
CCATTGGGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCAGGAC
TTAAGTACAAGCCTGTCTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGTAAAT
TGCTAGATTTCTGCAAGTCGAAAGATATTGTTCTGGTTGCCTATAGTGCTCTGGGATCTC
AACGAGACAAACGATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTCCTTT
GTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTGC
AGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAACGTGC
AGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGACAGAA
ATCTCCACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCAGATG
AATATTAACATGGAGAGCTTTGCCTGATGTCTACCAGAAGCCCTGTGTGTGGATGGTGAC
GCAGAGGACGTCTCTATGCCGGTGACTGGACATATCACCTCTACTTAAATCCGTCCTGTT
TAGCGACTTCAGTCAACTACAGCTGAGTCCATAGCCCAGAAAGACAATAAATTTTTATCA
TTTTGAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_003739
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003739.4, NP_003730.4
RefSeq Size 1224 bp
RefSeq ORF 972 bp
Locus ID 8644
UniProt ID P42330
Cytogenetics 10p15.1
Protein Families Druggable Genome
Protein Pathways Arachidonic acid metabolism, Metabolism of xenobiotics by cytochrome P450
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes one of the larger isoforms (1).
Write Your Own Review
You're reviewing:AKR1C3 (NM_003739) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200210 AKR1C3 (Myc-DDK-tagged)-Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3) 10 ug
$300.00
RC200210L1 Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), Myc-DDK-tagged 10 ug
$600.00
RC200210L2 Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), mGFP tagged 10 ug
$600.00
RC200210L3 Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), Myc-DDK-tagged 10 ug
$600.00
RC200210L4 Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), mGFP tagged 10 ug
$600.00
RG200210 AKR1C3 (tGFP-tagged) - Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.