HEMK2 (N6AMT1) (NM_182749) Human Untagged Clone

SKU SC321454

N6AMT1 (untagged)-Human N-6 adenine-specific DNA methyltransferase 1 (putative) (N6AMT1), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: HEMK2
• Synonyms: C21orf127; HEMK2; KMT9; m.HsaHemK2P; MTQ2; N6AMT; PRED28; PrmC
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_182749.2 CGAAGGACTATGGCAGGGGAGAACTTCGCTACGCCGTTCCACGGGCACGTGGGCCGCGGC; GCCTTCAGCGACGTGTACGAGCCCGCGGAGGACACGTTTCTGCTTTTGGACGCGCTCGAG; GCAGCGGCTGCCGAACTGGCAGGAGTGGAAATATGCCTGGAAGTAGGGTCAGGGTCTGGT; GTAGTATCTGCATTCCTAGCCTCTATGATAGGCCCTCAGGCTTTGTACATGTGCACTGAT; ATCAACCCTGAGGCAGCAGCTTGTACCCTAGAGACAGCACGCTGTAACAAAGTTCACATT; CAACCAGTTATTACAGATTTGGTAGGAAGTCACGGAATAGAGGCAGCTTGGGCTGGTGGC; AGAAATGGTCGGGAAGTCATGGACAGGTTTTTTCCCCTGGTTCCAGATCTCCTTTCACCA; AGAGGATTATTCTATTTAGTTACCATTAAAGAAAACAACCCAGAAGAAATTTTGAAAATA; ATGAAGACAAAAGGTCTGCAAGGAACCACTGCACTTTCCAGACAAGCAGGCCAAGAAACT; CTTTCAGTCCTCAAGTTCACCAAGTCTTAGCATACAGTGTGTGCCCAGAACTACTGGAAA; CTGAATGCATTTAGCATATTTTGAAACTGAAGTCATTCATTAGGTAACAAGGAATTTTAT; CAGAAATTTGTCATTAAAAAAAGGTAGAAAGGTGGAACATTCCCTTTCAGTCAGGCCTAT; AGAATTATTTGCACAAGTACAAGTAAATATGTGTATTATAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_182749
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_182749.2, NP_877426.2
• RefSeq Size: 4799 bp
• RefSeq ORF: 561 bp
• Locus ID: 29104
• UniProt ID: Q9Y5N5
• Cytogenetics: 21q21.3
• Protein Families: Druggable Genome
• Summary: This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]; Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.