CCL28 (NM_148672) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CCL28 |
Synonyms | CCK1; MEC; SCYA28 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_148672.2
GGGGAGGGCAGGCAGGAATGCAGCAGAGAGGACTCGCCATCGTGGCCTTGGCTGTCTGTG
CGGCCCTACATGCCTCAGAAGCCATACTTCCCATTGCCTCCAGCTGTTGCACGGAGGTTT CACATCATATTTCCAGAAGGCTCCTGGAAAGAGTGAATATGTGTCGCATCCAGAGAGCTG ATGGGGATTGTGACTTGGCTGCTGTCATCCTTCATGTCAAGCGCAGAAGAATCTGTGTCA GCCCGCACAACCATACTGTTAAGCAGTGGATGAAAGTGCAAGCTGCCAAGAAAAATGGTA AAGGAAATGTTTGCCACAGGAAGAAACACCATGGCAAGAGGAACAGTAACAGGGCACATC AGGGGAAACACGAAACATACGGCCATAAAACTCCTTATTAGAGAGTCTACAGATAAATCT ACAGAGACAATTCCTCAAGTGGACTTGGCCATGATTGGTTGTAAGTTTATCATCTGAATT CTCCTTATTGTAGACAACAGAACAAAACAAAATATTGGTTTTTAAAAAATGAACAATTGT GCGGTATGCAAATGTAGCCAATAATATACTCAACTGGAAAATGAAATGAAAAGATAATAC TGGCTGGGTATGGTGGTTCACACCTTTTATCCCAGCACTTCGGGAGGCTGAGGCAGGAGG ATCACTTGAGACCAGGAGTTTGAGACCAGCCTGGGCAACATAGCAAGACCTCATTTCTAC AAACAAAAAAAAAATTGGCCCGGCATGGTGGTACTTGCCTGTAGTCCCAGCCACATGGGA GGCTGAGGTGGGAGGATCACTTGAGTCTGGGAGAGTTTGAGGTTGCAGTGAGCAGCCTGG GTGACAGAATGAGACCCTGTCTCTAAAAATAATAATAATAATGATAGTGTATATCTTCAT ATAATATTTTAAGAGGAGCATATAGATATAACTTCTCCCAACTTTTTAATTATAGTTTTC CAAACTTACAGAGAAGTTAAAAGAATGGTACAATGAACATCTATATATCTTTCACCACAA TATTAATCATTGTTAATATTGTGTCACATTTGCTTTCTCTCTCCTCTCTTTGTATGTGTT TCTATATAAAATATTATAACTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_148672 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_148672.2, NP_683513.1 |
RefSeq Size | 816 bp |
RefSeq ORF | 384 bp |
Locus ID | 56477 |
UniProt ID | Q9NRJ3 |
Cytogenetics | 5p12 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Summary | This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC209344 | CCL28 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 28 (CCL28) | 10 ug |
$150.00
|
|
RC209344L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 28 (CCL28), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC209344L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 28 (CCL28), mGFP tagged | 10 ug |
$450.00
|
|
RG209344 | CCL28 (tGFP-tagged) - Human chemokine (C-C motif) ligand 28 (CCL28) | 10 ug |
$489.00
|
|
SC306320 | CCL28 (untagged)-Human chemokine (C-C motif) ligand 28 (CCL28) | 10 ug |
$165.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.