EMG1 (NM_006331) Human Untagged Clone

SKU
SC321124
EMG1 (untagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EMG1
Synonyms C2F; Grcc2f; NEP1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006331.4 GGGGGCGTTAGCGCAACTTCCGGTATTGTTGCAAGATGGCCGCGCCCAGTGATGGATTCA
AGCCTCGTGAACGAAGCGGTGGGGAGCAGGCACAGGACTGGGATGCTCTGCCACCCAAGC
GGCCCCGACTAGGGGCAGGAAACAAGATCGGAGGCCGTAGGCTTATTGTGGTGCTGGAAG
GGGCCAGTCTGGAGACAGTCAAGGTAGGGAAGACATATGAGCTACTCAACTGTGACAAGC
ACAAGTCTATATTGTTGAAGAATGGACGGGACCCTGGGGAAGCGCGGCCAGATATCACCC
ACCAGAGTTTGCTGATGCTGATGGATAGTCCCCTGAACCGAGCTGGCTTGCTACAGGTTT
ATATCCATACACAGAAGAATGTTCTGATTGAAGTGAATCCCCAGACCCGAATTCCCAGAA
CCTTTGACCGCTTTTGTGGCCTCATGGTTCAACTTTTACACAAGCTCAGTGTTCGAGCAG
CTGATGGCCCCCAGAAGCTTTTGAAGGTAATTAAGAATCCAGTATCAGATCACTTTCCAG
TTGGATGTATGAAAGTTGGCACTTCTTTTTCCATCCCGGTTGTCAGTGATGTGCGTGAGC
TGGTGCCCAGCAGTGATCCTATTGTTTTTGTGGTAGGGGCCTTTGCCCATGGCAAGGTCA
GTGTGGAGTATACAGAGAAGATGGTGTCCATCAGTAACTACCCCCTTTCTGCTGCCCTCA
CCTGTGCAAAACTTACCACAGCCTTTGAGGAAGTATGGGGGGTCATTTGACAGTAGTAGA
ACCTGTTCTGAAACCAGAAACTGTTGATGTCACATCCTTTGACCCTGGTCTGAGCTGACT
GCTGGAAGATGATCTTTCTGCACTGAGACTGTGGAGTTTGGGGAAGCCAAGGCTGTACAT
TTGCTATTTGTTTATCCTATGAATACTGTTCTTGCAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_006331
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006331.4, NP_006322.2
RefSeq Size 1019 bp
RefSeq ORF 735 bp
Locus ID 10436
UniProt ID Q92979
Cytogenetics 12p13.31
Domains Mra1
Summary This gene encodes an essential, conserved eukaryotic protein that methylates pseudouridine in 18S rRNA. The related protein in yeast is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).
Write Your Own Review
You're reviewing:EMG1 (NM_006331) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208885 EMG1 (Myc-DDK-tagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1) 10 ug
$300.00
RC208885L1 Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), Myc-DDK-tagged 10 ug
$600.00
RC208885L2 Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), mGFP tagged 10 ug
$600.00
RC208885L3 Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), Myc-DDK-tagged 10 ug
$600.00
RC208885L4 Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), mGFP tagged 10 ug
$600.00
RG208885 EMG1 (tGFP-tagged) - Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC315700 EMG1 (untagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.