DLK (DLK1) (NM_003836) Human Untagged Clone

SKU
SC320741
DLK1 (untagged)-Human delta-like 1 homolog (Drosophila) (DLK1)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DLK
Synonyms Delta1; DLK; DLK-1; FA1; pG2; Pref-1; PREF1; ZOG
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003836.4 GAGAGCGCAGCGCGCAGCCCGGTGCAGCCCTGGCTTTCCCCTCGCTGCGCGCCCGCGCCC
CCTTTCGCGTCCGCAACCAGAAGCCCAGTGCGGCGCCAGGAGCCGGACCCGCGCCCGCAC
CGCTCCCGGGACCGCGACCCCGGCCGCCCAGAGATGACCGCGACCGAAGCCCTCCTGCGC
GTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGGCTGAATGCTTCCCGGCC
TGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCCTGGCTGG
CAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGA
GAACCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTT
CGGGCCTGCTCCTCGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGC
CTCTATGAATGCTCCTGTGCCCCCGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGG
CCCTGTGTGATCAACGGCTCCCCCTGCCAGCACGGAGGCACCTGCGTGGATGATGAGGGC
CGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAGGCAATTTCTGCGAGATC
GTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGACATCGGG
GGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTG
ACCAACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTG
AGCTACGAGTGTCTGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCG
CTGAGCCCCCAGCAGGTCACCCGTCTGCCCAACGGCTATGGGCTGGCCTACCGCCTGACC
CCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCGGAGCACCGCATCCTGAAGGTGTCCATG
AAAGAGCTCAACAAGAAAACCCCTCTCCTCACCGAGGGCCAGGCCATCTGCTTCACCATC
CTGGGCGTGCTCACCAGCCTGGTGGTGCTGGGCACTGTGGGTATCGTCTTCCTCAACAAG
TGCGAGACCTGGGTGTCCAACCTGCGCTACAACCACATGCTGCGGAAGAAGAAGAACCTG
CTGCTTCAGTACAACAGCGGGGAGGACCTGGCCGTCAACATCATCTTCCCCGAGAAGATC
GACATGACCACCTTCAGCAAGGAGGCCGGCGACGAGGAGATCTAAGCAGCGTTCCCACAG
CCCCCTCTAGATTCTTGGAGTTCCTCAGAGCTTACTATACGCGGTCTGTCCTAATCTTTG
TGGTGTTCGCTATCTCTTGTGTCAAATCTGGTGAACGCTACGCTTACATATATTGTCTTT
GTGCTGCTGTGTGACAAACGCAATGCAAAAACAATCCTCTTTCTCTCTCTTAATGCATGA
TACAGAATAATAATAAGAATTTCATCTTTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_003836
Insert Size 1500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003836.4, NP_003827.3
RefSeq Size 1532 bp
RefSeq ORF 1152 bp
Locus ID 8788
UniProt ID P80370
Cytogenetics 14q32.2
Domains EGF, EGF_CA
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Summary This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:DLK (DLK1) (NM_003836) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202923 DLK1 (Myc-DDK-tagged)-Human delta-like 1 homolog (Drosophila) (DLK1) 10 ug
$686.00
RC202923L1 Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), Myc-DDK-tagged 10 ug
$986.00
RC202923L2 Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), mGFP tagged 10 ug
$986.00
RC202923L3 Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), Myc-DDK-tagged 10 ug
$986.00
RC202923L4 Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), mGFP tagged 10 ug
$986.00
RG202923 DLK1 (tGFP-tagged) - Human delta-like 1 homolog (Drosophila) (DLK1) 10 ug
$489.00 MSRP $886.00 MSRP $886.00
SC127962 DLK1 (untagged)-Human delta-like 1 homolog (Drosophila) (DLK1) 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.