TMS1 (PYCARD) (NM_145183) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | TMS1 |
Synonyms | apoptosis-associated speck-like protein containing a CARD; ASC; ASC, TMS1, CARD5, MGC10332; CARD5; caspase recruitment domain protein 5; MGC10332; PYD and CARD domain containing; target of methylation-induced silencing-1; TMS; TMS-1; TMS1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_145183.1
GCGCGATCCTGGCGTCCCCCGACGGCCTGGGGCCCCAATCCAGAGGCCTGGGTGGGAGGG
GACCAAGGGTGTAGTAAGGAAGCGCCTTTTGCTGGAGGGCAACGGACCGGGGCGGGGAGT CGGGAGACCAGAGTGGGAGGAAGGCGGGGAGTCCAGGTTCCGCCCCGGAGCCGACTTCCT CCTGGTCGGCGGCTGCAGCGGGGTGAGCGGCGGCAGCGGCCGGGGATCCTGGAGCCATGG GGCGCGCGCGCGACGCCATCCTGGATGCGCTGGAGAACCTGACCGCCGAGGAGCTCAAGA AGTTCAAGCTGCAGGCGGCCACGCACCAGGGCTCTGGAGCCGCGCCAGCTGGGATCCAGG CCCCTCCTCAGTCGGCAGCCAAGCCAGGCCTGCACTTTATAGACCAGCACCGGGCTGCGC TTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGA CGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGC TCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAA GGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGAGGCTCCTTCCCAGCAA CACTCCGGTCAGCCCCTGGCAATCCCACCAAATCATCCTGAATCTGATCTTTTTATACAC AATATACGAAAAGCCAGCTTGAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_145183 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_145183.1, NP_660184.1 |
RefSeq Size | 763 bp |
RefSeq ORF | 408 bp |
Locus ID | 29108 |
Cytogenetics | 16p11.2 |
Protein Families | Druggable Genome |
Protein Pathways | Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway |
Summary | This gene encodes an adaptor protein that is composed of two protein-protein interaction domains: a N-terminal PYRIN-PAAD-DAPIN domain (PYD) and a C-terminal caspase-recruitment domain (CARD). The PYD and CARD domains are members of the six-helix bundle death domain-fold superfamily that mediates assembly of large signaling complexes in the inflammatory and apoptotic signaling pathways via the activation of caspase. In normal cells, this protein is localized to the cytoplasm; however, in cells undergoing apoptosis, it forms ball-like aggregates near the nuclear periphery. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate in-frame splice site for an internal coding exon, compared to variant 1. This results in a shorter isoform (c) missing a segment of 60 aa, compared to isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202409 | PYCARD (Myc-DDK-tagged)-Human PYD and CARD domain containing (PYCARD), transcript variant 3 | 10 ug |
$150.00
|
|
RC202409L3 | Lenti ORF clone of Human PYD and CARD domain containing (PYCARD), transcript variant 3, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC202409L4 | Lenti ORF clone of Human PYD and CARD domain containing (PYCARD), transcript variant 3, mGFP tagged | 10 ug |
$450.00
|
|
RG202409 | PYCARD (tGFP-tagged) - Human PYD and CARD domain containing (PYCARD), transcript variant 3 | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.